Írj nekünk! Kövess minket!

Kövess a Twitter-en 

Melléfogott az asztrológusod? Nem találsz már helyet az ágyadnak a földsugárzástól? Össze-vissza forog az Egely- kereked? Nem használt a macskádnak a homeopátiás bogyó?

Írd meg nekünk:
blog (kukac) szkeptikus.hu

Utolsó kommentek

Híreink

  • Nincs megjeleníthető elem

Fórum

  • Nincs megjeleníthető elem

Címkék

akupunktúra (2) álhírek (1) állampolgári tudomány (1) alternatív medicina (23) áltudomány (37) antibiotikum (1) apollo (1) aromaterápia (1) ásványok (1) asztaltáncoltatás (1) asztrológia (6) atomenergia (2) attila domb (1) átverés (14) aura (2) béky lászló (3) bioenergetika (5) biofoton (1) biológia (1) biologika (1) bioptron (2) biorezonancia (5) biotechnológia (8) boszniai piramisok (3) bulvár (1) butaság (7) bűvészet (9) callahan (1) cam (1) chemtrail (3) clairvoyance (1) cod tea (5) confirmation bias (1) covid-19 (1) criss angel (1) csalás (4) csillagászat (6) cunami (1) darwin (5) demarkáció (1) diéták (1) douglas adams (1) dr. csabai zsolt (2) echo tv (1) ECSO (1) egely (2) egészség (36) egészségnap (2) éghajlat (1) einstein (3) elektroszmog (1) életmód (4) energia (1) eric pearl (1) értem (3) érvelés (1) etnográfia (1) étrend kiegészítő (6) eugenika (1) evolúció (21) ezóbióökó (7) ezotéria (27) fakír (1) fals pozitív (1) fekete mágia (2) felmelegedés (2) filozófia (11) finnugor (1) fizika (12) fogyasztóvédelem (12) földönkívüliek (2) földsugárzás (3) gender (1) glifozát (1) gondolkodás (6) grafológia (2) grapefruit (3) grape vital (2) gyermeknevelés (1) gyógynövények (2) gyógyszerek (1) gyógyszeripar (1) HAARP (1) hagyományos kínai orvoslás (3) hamisítás (3) hétköznapi bölcsesség (1) hipotézis (1) hold (2) holokauszt (1) homeopátia (22) horoszkop (3) humor (7) idegtudomány (1) ideomotoros (1) idősek (1) india (1) influenza (1) ingyenenergia (4) integratív medicina (2) intelligens tervezés (12) james randi (3) japán (1) járvány (2) járványtagadás (1) jeti (1) jövőbelátás (1) jövőbelátók egyháza (1) jövőbe látás (2) józan ész (4) kanálhajlítás (2) kapcsolatteremtő gyógyítás (1) kígyóolaj (1) kísérlet (3) kiválasztott (4) klímaváltozás (7) klub (89) konferencia (9) kongresszus (10) könyv (13) koplalás (1) koronavírus (4) közgazdaságtan (2) közlekedés (1) kozmológia (2) kreacionizmus (2) kristályok (1) kritika (1) lászló ervin (2) lebuktatás (1) légköroptika (1) lenkei gábor (1) levitt (1) lifewave (2) lottó (1) lúgosítás (1) magfúzió (1) mágia (1) mágnes (5) magyar őstörténet (4) magyar történelem (3) marketing (3) mars (3) matematika (3) média (6) megerősítési torzítás (5) mellrák (1) mentalizmus (3) mesterséges intelligencia (1) meteor (1) mobiltelefon (1) mta (4) művészet (1) nasa (2) nyelv (6) nyílt levél (1) oktatás (4) oltásellenesség (3) oltások (2) önámítás (1) online kísérlet (3) orgon (1) örökmozgó (5) orvostudomány (12) őssejtfokozó (1) összeesküvés elmélet (5) otthonszülés (1) paleolit étrend (1) pálmalevél (1) pályázat (1) pandémia (1) parafenomén (3) parajelenségek (6) paródia (1) PCR (1) phenomenon (2) podcast (1) pozitív gondolkodás (1) prána (2) probiotikum (1) proving (1) pszí (5) pszichiátria (1) pszichológia (1) racionalitás (1) radiesztézia (3) rák (8) randi (3) rendezvény (13) rezsicsökkentő (1) richard dawkins (2) sci fi (3) seti (1) spiritizmus (2) steorn (1) sugárzás (3) számmisztika (3) székesfehérvár (2) szekta (1) szellemidézés (3) szerencse (1) sziget (5) szkeptikus (20) szólásszabadság (1) találmány (4) tantra (1) táplálkozás (5) távgyógyítás (2) technológia (13) telekinézis (1) telepátia (1) televízió (5) teremtés (3) teremtéstan (2) természetgyógyászat (28) termográfia (1) tesztek (3) történelem (14) tudomány (30) tudományos módszer (2) tudománytörténet (1) turizmus (1) ufo (5) új germán medicina (2) űrhajózás (1) uri geller (8) űrszonda (2) vágó (6) vakcinák (2) vallás (2) villanyóralassító (1) vita (1) vízautó (2) Wikipédia (3) x akták (1) Címkefelhő

Creative Commons

Creative Commons Licenc

2010.12.09. 06:09 maycontainnuts

Birkózók a kötéltáncosok ellen

A nagy Evolúció–Értelmes Tervezettség vita I.

(sokadik meccs, első menet)

Ember tervez, a Tervező is tervez. Sosem végzünk ezzel?

A Szkeptikus Társaság és az Értelmes Tervezettség Mozgalom kulturált vitája már zajlik néhány hete, így a legújabb ütésváltás előtt talán hasznos lehet összefoglalni az eddigi eseményeket, némi kitekintéssel az elmúlt évszázadokra is.

Az előző meccsek rövid összefoglalása:

Az élőlények eredetét, mivel nem maradtak róla írásos emlékek, évezredeken át meseszerű leírások alapján képzelték az emberek, és az iskolákban is jobb híján ezeket tanították. Ezek voltak a vallásos eredetű (kreacionista) teremtéstörténetek.

Aztán feltűnt Charles Darwin és még sokan mások, akik nem egy mesét, hanem egy történet kereteit vázolták fel (persze sok meseszerű példával), azonban ennek a furcsa történetfolyamnak volt néhány alapvető eltérése a korábbi meséktől:

  • Ellenőrizhetőek voltak a benne szereplő példák, és bárki által megfigyelhetőek.
  • Nem szerepeltek benne olyan meseszerű lények, amelyek működése alapvetően eltért volna az ismert élőlények tulajdonságaitól, sőt ellentmondott volna nekik.
  • Voltak benne vitatott elemek, de a világ tudósai között nem voltak akkora ellentétek, mint a korábbi mesék között.

A korábbi meseelemeket nélkülöző elméletek közül a Darwin-féle lett a legismertebb, és ez képezte alapját a ma iskolákban is tanított evolúcióelméletnek.

A fentebb felsorolt indokok miatt a régivágású történetek veszítettek népszerűségükből, és kiszorultak többek között a biológiaoktatásból, helyüket az evolúció foglalta el.

Évtizedekig próbálkoztak a régivágású történetek szerelmesei, ill. szerzői, hogy tananyaggá formálják meséiket (legnagyobb hatással az Egyesült Államokban), de ennek szintén a fenti felsorolásban szereplő ellentmondások állták útját.

És még valami: az Egyesült Államok alkotmányának I. kiegészítése. Ennek alapján több ítéletben is kimondták, hogy nem lehet az iskolai természettudományos oktatásban valamelyik régivágású történetet előnyben részesíteni, és annak alapján természettudományt tanítani.

Ezt felismerve mint a probléma gyökerét, megoldást kerestek és majdhogynem találtak is: Nem több adat kell elméletünk alátámasztására, hanem legyen kevesebb állításunk, hogy ne lehessen minket kritizálni! Tegyünk bele legalább egy meseszerű lényt, de ne mondjunk róla semmit. Mondjuk azt, hogy az élőlények egymástól származása lehetetlen, de ne javasoljunk helyette semmit. Lebegtessük, hogy részben elfogadjuk az evolúciót, de ne mondjuk meg pontosan, hogy mekkora részben!

Így a régivágású kreacionista történeteket megnyirbálták, megszabadítva azt az ellenőrizhető tények terhétől. Előlépett az Intelligens Tervezettség (Magyarországon Értelmes Tervezettség) mozgalma.

Ezt azonban az Értelmes Tervezettség mozgalma sem szereti elismerni, hanem kifejezetten tiltakozik ellene. Ami elég furcsa annak fényében, hogy az Értem Egyesület saját „szakirodalmaként” elismert, „Of pandas and people” című tankönyv eredetileg kreacionista tankönyvnek készült, amelyet átszerkesztettek a „kreacionista” kifejezést „Intelligens Dizájn támogatója”, a „kreacionizmus”-t pedig „Intelligens Dizájn”-ra cserélve a szövegben.

Részben emiatt a következő perben is az evolucionista álláspontot képviselőknek adott igazat a bíróság az értelmes tervezettség híveivel szemben, de persze ennek ellenére is maradtak olyanok, akik tovább küzdenek már többször is elvesztett ügyükért.

Ennek a küzdelemnek legújabb hazai felvonása a Szkeptikus Társaság és az Értem Mozgalom közötti blogvita megjelenése.

 

A vita eddigi történéseiként megjelent négy öt, 10 000 karakter körüli írás olvasható a vitablogon, de összefoglalnám az eddig történteket egy (felemás) bokszmeccs-allegória keretében.

A kék sarokban tehát az Evolúcióelmélet és hívei (jelen esetben a Szkeptikus Társaság tagjai által képviselve).

Az Evolúció már majdnem 150 éve közös természettudományos platform az élőlények sokszínűségének kialakulását vizsgáló tudósok között, mellesleg számos – biológián kívüli – tudomány berkeiben is nagy jelentőséggel bír, valamint számos hasznos találmány és kutatási terület alapja, végül pedig legalább 386 zenei album címében is szerepel.

Velük szemben a piros sarokban az amerikai elnevezés (Intelligent Design) alapján ID-nek rövidített, néhány évtizedes múltra visszatekintő Értelmes Tervezettség elmélete, amit a róla elnevezett mozgalom képvisel. Az elmélet biológiai, valamint esetlegesen egyéb irányú eredményei még váratnak magukra. Albumot ismereteink szerint hármat adtak ki eddig ezzel a címmel.

Rapvideóból is több van evolúcióalapú

A Magányos Harcos

Meszéna Géza nyitja a vitát, a ringbe mászva megfeszíti izmait és nekilódul feltérképezni az ellenfél gyöngeségeit és erősségeit. Minden végtagja egy tudományág, ujjai segédtudományok, melyeket ökölbe szorítva várja, hogy az ID belékössön. Kezében neves biológusok munkáját lobogtatja, hátha legalább azt elolvassák ellenfelei.

Első megvitatandó kérdés, hogy „Ésszerű válaszlehetőség-e az intelligens tervezettség az élővilág eredetére?” Az ellenfelek távollétében azonban hiába is érvelne bármivel, emiatt színvallásra próbálja kényszeríteni ellenfeleit, ha már az ő elméletükre irányul a kérdés:

„...vitapartnereink határozzák meg pontosan álláspontjukat a tekintetben, hogy mit fogadnak el, és mit nem egyrészt az evolúcióbiológia, másrészt a modern természettudomány egészének álláspontjából, illetve tegyék nyilvánvalóvá, hogy a számos, egymásnak kölcsönösen ellentmondó evolúciótagadó irányzat melyikét képviselik, mit állítanak egészen pontosan.”

Mi ez az értelmes tervezettség? Miről beszélnek egyáltalán? Mit fogadnak el az evolúcióelméletből, és mit vitatnak belőle? És legalább azt árulják el, hogy hány millió éves Földet képzelnek az élet táptalajául. Legalább ezt az egyet árulják el.

Felbukkan az Értelmes tervezettség kötéltánc-csoportja

Hiába azonban minden, az ellenfél nem lép az arénába.

Tasi István és dr. Farkas Ferenc a ring körüli kötélkorláton ugrálnak és nem akarnak a kérdések hatókörébe kerülni. A Föld korára vonatkozó kérdést ezzel ütik el:

„Az ID támogatóinak többsége – így e sorok szerzői is – elfogadják a Föld több millió éves korát.”

De azt elfelejtik kifejteni, hogy ez a „millió éves kor” az ID egyik központi alakjának, Michael Behe-nek tudományos álláspontot tisztelő, 4,5 milliárd évet elfogadó álláspontja, a Tasi István által támogatott védikus kreacionizmus soktrillió éve, vagy valami más. Ugyanígy nem említik, hogy az ID szemlélet egyes képviselői (pl. az általuk gyakorta hivatkozott Dean H. Kenyon) által vallott, 10–20 000 éves Univerzumot tartalmazó álláspont vajon miért idegen tőlük.

Annak ellenére, hogy önálló tudományos elméletnek tartják magukat, már a harmadik bekezdésben egy evolúciót támogató, neves tudóst citálnak álláspontjuk kifejtésére a tervezettség hívei.

Róla is van rapvideó, amit az ID finanszírozott. Köszönjük, remek lett.

Bemutatnak két allegóriát (egy homokvárat és egy szerelőcsarnokot) az értelmet nélkülöző tervezés lehetetlenségére, elfelejtve, hogy az élő szervezeteket nem szerelőcsarnokban alkotják, ahogy az ifjú homokvárak sem idősebb homokvárak párzásából alakulnak ki.

A kötéltáncosok ezután, saját álláspontjuk bemutatását mellőzve, vélt ellenfelüknek igyekeznek ütéseket bevinni, de csak papírgalacsinokat dobálnak a küzdőtérre, saját cikkeikre mutató linkek formájában. Ezek a saját honlapjuk szinte hermetikusan elzárt világába mutatnak, ahol egymásnak ellentmondó világképű emberek többszörösen cáfolt munkáira hivatkoznak, félreértelmezik tényleges biológusok idézeteit, illetve renegát, kisebbségi álláspontot képviselő tudós véleményét képesek beállítani egy rangos tudományos folyóirat álláspontjaként. Ha valakinek esetleg ellenvetése lenne az adott cikkel szemben, akkor kommentelnie lehetetlen, és általában ugyanígy lehetetlen a honlap alapján rátalálni az ID által kritizált tudós eredeti tanulmányára is.

Itt jegyezném meg, hogy amennyiben az Értem tagjai pontatlanságokat találnának jelen írásban, az alant elfekvő kommentdobozba nyugodtan írhatnak.

A vehemensebb hozzászólóknak pedig jelezném, hogy továbbra is próbálnánk a vitát nem terelni abba az irányba, hogy kinek mi a személyes véleménye a másik táborról, és főleg annak tagjairól. Örülnénk, ha ez a vita nem a felek stílusára terelődne, emiatt a sértő kijelentések továbbra is korlátozás alá eshetnek, származzanak azok bármelyik oldalról. - maycontainnuts

Az Értem által linkelt témákra könnyen lehet az evolúciós álláspontot alátámasztó választ találni, többek között a www.talkorigins.org honlapon, ahol egy kimerítő lista is található az evolúciót kétségbe vonó kijelentésekről, azok szintén kimerítő kritikájával egyetemben.

Néhány érv cáfolata az intelligens tervezettség kelléktárából

A kötéltánc mesterei egy rövid listát is ráznak a ring felé „szakirodalmuk” műveinek felsorolásával, elfelejtve megemlíteni, hogy a művek jelentős részét mindenfajta biológusi végzettség nélküli emberek írták (újságírók, jogászok, kreatív írók), és azok témája általában kimerül az evolúcióelmélet elszánt kritikájában, vagy akár jogelméleti fejtegetésekben, miközben alig tesznek önállóan vizsgálható kijelentéseket.

Egy hosszasabb listát is mutogatnak, amin „doktori fokozatot szerzett tudósok” (legyenek akár jogászok vagy filozófusok) 800 fős tömege nyilatkozik arról, hogy támogatja a darwinizmus (nem pedig az evolúcióelmélet!) alapos vizsgálatát. Fura módon azt elfelejtik megemlíteni, hogy a 800 fős tömegből hányan támogathatják az értelmes tervezettséget, mert a listához mellékelt „gyakran ismételt kérdések” 5. pontjából kitűnik, hogy annak aláírásával sem az Értelmes Tervezettség, sem bármely más elmélet (strukturalizmus, önszerveződés, stb.) mellett nem tesz nyilatkozatot az aláíró. Akkor miért az evolúció–értelmes tervező vitában hozzák fel ezt a listát, amikor a két érintett elmélet közül egyikről sem nyilatkoztak az aláírók?

Végül a tudományos alátámasztottságuk hiányát ideológiai ellentéteknek tudják be, elfelejtve azt, hogy 150 évvel ezelőtt is ideológiai ellentétek viharában, de nem saját álláspont nélkül éppen az evolucionizmus szorította ki szellemi elődeiket a biológiaóráról.

A Veterán színre lép

Zsámboki János lép a pástra, számtalan összecsapásban edződött, rutinos debattőrként felméri, hogy az ellenfél még mindig nincs a ringben, így a kötelek mentén kezdi el őket terelni. Gyorsan megveti lábát az arénában és felvázolja, hogy milyen alapfeltételei vannak egy evolúciós rendszernek:

  1. Az egyedek saját tulajdonságaikat az utódaikra örökítsék.
  2. Ebben a folyamatban időnként hibák történjenek.
  3. Az egyes egyedek szaporodási esélye különböző legyen, öröklött tulajdonságaik függvényében.

Ezzel lesöpöri az omladozó homokvár és a szerelőcsarnok maradékát, majd 14 jól irányzott kérdéssel betereli a kötéltáncosokat az egyik sarokba, és papírgalacsinjaikon tapodva elkezdi kicsavarni a kezükből érveiket.

Mit jelent az ID azon kijelentése, hogy a mutációk főleg károsak vagy semlegesek? Akkor a sarlósejtes vérszegénység, ami Skandináviában káros, a Kongó vidékén előnyös, Ázsia egyes részein pedig semleges, az akkor most melyik? – kérdezi.

Az Értem kötéltáncosai egyetlen kérdést tettek fel, amelyik nem tekinthető költőinek, vagy nem válaszolták meg saját maguk:

"Lehetséges-e, hogy a fajok mai jellegzetességei a leszármazás folyamata során, korábbi fajok apró átalakulásai révén jöttek létre? Bár vitapartnerünk szerint „sok-sok példát” lehet erre mutatni, érdekes módon egyet sem említ közülük."

Veterán harcosunk azonnal előránt egy félig retek, félig káposzta élőlényt, amelynek keletkezésekor több elfogadott fajfogalom szerint is vitathatatlanul két fajból egy elkülönült, harmadik faj jött létre, és csiklandozni kezdi vele a sarokba szorultak orrát.

Persze akár kibújhatnának az őket fenyegető, dokumentált fajkeletkezési esemény árnyékából az ÉRTEM szerzői, csak akkor egy új fajmeghatározást kellene hozniuk, amit ők elfogadnak. Ezt izgatottan várja cikkírónk is, akinek remélhetően van a mellényzsebében minden ismert fajmeghatározásra passzoló evolúciós példája, csak addig felesleges előszedni azokat, amíg az ellenfél nem nyilatkozik, hogy melyik fajfogalom szerint (van belőle vagy két tucatnyi) nem látnak példát az evolúcióra.

Zsámboki János végül a darwini evolúció (felül)vizsgálatát szorgalmazó tudósok listájára is szolgál egy mennyiségi és egy jóval elegánsabb ellenérvvel is, majd mosolyogva várja, hogy a ring délkeleti oszlopára csavarodott Értemesek lejönnek-e végre küzdeni. Merthogy eddig nem reagáltak az Értelmes Tervezettség ésszerűségével foglalkozó vita Értelmes Tervezettségre vonatkozó kérdéseire.

Kitörési kísérlet, vagy menekülés az arénából?

Sajnálattal látom, hogy a táncosok továbbra sem lépnek ki a kötelek közül a vita tényleges mezejére, hanem elindultak egy hosszú sarokoszlopon felfelé, és közben még mindig prüszkölnek az orruk alá nyomott káposztaretektől. Az alapkérdésre hiányolják választ, miközben nemhogy Zsámboki János, hanem még Meszéna Géza kérdésére se válaszoltak. Az Értem 2. válaszából pont annyira nem lehet érteni az Értelmes Tervezettség álláspontját, mint az első válaszukból, vagy amennyire nem lehetett értelmezni egységesen elképzeléseiket előtte sem.

Épp ezért tettek fel nekik kérdéseket. Igaz, még mindig van 8x10 000 karakternyi lehetősége erre az ÉRTEM-nek, csak mintha a pontozásra várnának, hátha az kedvezőbb lesz rájuk nézve, mint egy esetleges kiütés. Némi személyeskedés után megpróbálnak ismételten az evolúcióval kapcsolatos, általuk látni vélt hiányokról szónokolni, pedig még ezen hiányosságok tényleges megléte sem támasztaná alá az Értelmes Tervezőről szóló elméletet.

Lekicsinylik a hemoglobinban tetten érhető változást is, ami megakadályozhatja a malária kialakulását, ugyanakkor Értelmesen Tervezett biológiai átalakulásra még mindig nem hoztak egy huncut példát se. Előkapják a „korlátozott plaszticitás” zászlaját, amelyet meglengetnek a magasban, emiatt friss festék hullik alá a korábban szintén általuk koptatott, eredeti "mikroevolúció" feliratról. Már azt a fogalmat is félrevezetően használták, de biztos túl sok volt benne az „evolúció”, emiatt a nevét is lecserélték.

A korlátozott plaszticitásról szóló, az ÉRTEM honlapján megjelent, legjobb szándékkal is csak dolgozatnak minősíthető művükben 100 nemesített növényfaj utóbbi 10 000 évét veszik górcső alá. Ezen, evolúciós szempontból rendkívül rövid időszak alatt (mellesleg ezzel végleg elvágva magukat a 6000 éves földi bioszférát vallók jelentős táborától) csak az alábbi változásokat jegyezték fel (lábjegyzetszinten):

„Mándy Gy. (1972) által felsorolt, megváltozott tulajdonságok a következők. 1. Az elterjesztést segítő jellegek hiánya: A vad alak törékeny kalászorsója helyett szilárd kalászorsó; Elpergő helyett erősen ülő szemek; Hosszú helyett rövid szálkák; Felnyíló termések helyett zárt termések; Pattanó helyett zárt hüvely; Apró helyett nagy termés és mag; Kemény helyett lágyhéjúság; Egyenetlen helyett egyidejű érés; Elhúzódó helyett egyöntetű csírázás; Hosszú helyett rövid tarackok; 2. A teljesítőképesség változása: Csekély helyett nagy teljesítőképesség; Kicsi termet helyett óriás méret; Kicsi helyett nagy gyökérzet vagy gumó; Ehetetlen részek helyett ízletes-ehető részek; Kisebb helyett nagyobb levelek; Csekély helyett nagy nyers- vagy szárazsúly; 3. Az élettani jellegek változása: Igényesség kialakulása a trágya és talaj iránt; Lassú helyett gyors fiatalkori növekedés.”

Felmerül a kérdés, hogy ha ezek a változások szerintük nem a növények evolúciójára utalnak, akkor milyen változásokat tekintenének bizonyítéknak? Táncoljanak a borsók? Nőjön füle az árpának, hogy meghallja az állatok közeledtét és még el is tudjon szaladni előlük? Reméljük, a legújabb válaszunkban feltett kérdésekre (vagy bármely korábbira) a következő megszólalásukból végre választ kapunk.

Eddig azonban úgy tűnik, hogy az Értem képviselői nem akarnak konkrétan válaszolni egyik kérdésünkre sem, hanem egyre messzebb küzdik magukat a küzdőtértől, és csupán szép tornagyakorlatokat mutatnak be egy póznán a magasban, miközben lábuk régen elszakadt a valóság talajától.

A veterán bosszúja

Zsámboki János jobb célpont híján kénytelen tovább rázni az Értem vitakommandóját tartó oszlopot, miközben félkézzel felvázol egy pont annyira „hasznos” elméletet, mint az Intelligens Tervezettség. És amelyikről már filmsorozat is készült!

Főszereplő, cselekmény és forgatókönyv hiányában sajnos az ID még nem megfilmesíthető

Természetesen egyéb trónkövetelők is vannak a fenti filmsorozaton túlmenően az Evolúció kihívói között, így ellenfeleink helyében igyekeznénk előállni gyorsan valami magyarázatfélével a kérdéseinkre. Ellenkező esetben még az is lehetséges, hogy az Értelmes Tervezettségnek – amennyiben szándékaiknak megfelelően tényleg bekerülnek a tantervbe – osztoznia kell az óraszámon az Értelmetlen Tervezettség mozgalom, a Szimulált Valóság hipotézis, vagy akár az Utolsó Csütörtökizmus híveinek előadásaival is.

De fogom sajnálni, hogy már nem vagyok diák!

Természetesen a mérkőzés jelenlegi állásának létezik másik olvasata is. A zsiráf felépítéséről viszont hiába olvasok többoldalnyi elemzést, ha a zsiráf tervezéséről nem írnak semmit, akkor ugyanannyit tudok a dologról, mint előtte. Semmit. Azt meg minek tanítani? Olyan az ID, mnt a zsiráf a viccben. Szép, szép, de otthonra tuti nem kéne. Az iskolába meg főleg.

1123 komment · 2 trackback

Címkék: vita evolúció értem intelligens tervezés


A bejegyzés trackback címe:

https://szkeptikus.blog.hu/api/trackback/id/tr422494026

Trackbackek, pingbackek:

Trackback: Isten egyértelműen kívül fekszik a tudomány hatókörén? 2010.12.13. 15:59:57

Sokan állítják ezt és sokan az ellenkezőjét. Az eddig általam fellelt kétoldalú oda-vissza érvelések egyike sem volt kellően pontos és általános érvényű Mint ismeretes kiírtam egy egy millió forintos pályázatot ateisták és szkeptikusok számára az Álta...

Trackback: Intelligens Design - Babona új köntösbe húzva 2010.12.09. 15:56:26

Egy erőszakos ideológia számtalan új és újabb trükkel igyekszik megakadályozni a végleges bukását. Pedig a fejlődés elsöpri őket. " Alkotmányellenesnek nyilvánították az intelligens tervezés nevű teremtéselmélet oktatását az állami iskolákban. A ...

lacalaca · http://cydonia.blog.hu 2010.12.09. 10:56:40

Én még kérném a Repülő Spagettiszörnyet is a tantervbe!

Egyébként a díványos cikknél (?...) is elég egyoldalú volt a vita, az ID hívei bizonyítékokat követeltek, majd mindről kijelentették, hogy az nekik nem jó. Nem tudom, hogy "új faj kialakulása" alatt pl mit kéne bemutatni: bálnák nőnek ki a búzacsírából? Mert ha ennél kisebb mértékű, akkor az nem is új faj, csak módosulása az előzőnek. Persze, messziről a zab meg az árpa is majdnem úgy néz ki, mint a búza, nem?

Ha az ID-ről követelt valaki bizonyítékot, akkor viszont mindig vol ultimate érv: "az evolúció rossz, mert...". Ez NEM_ÉRV_AZ_ID_MELLETT, legfeljebb az evolúció elleni lehet(ne, ha működne, lásd a gyáras/homokváras hasonlatokat).

Ezt pedig most találtam az ÉRTEM honlapon:
ertem.hu/page/hataratlepok/
Más szemében a szálkát...

egy csónakban 2010.12.09. 11:37:30

> ertem.hu/page/hataratlepok/

szerintem korrekt Falus András véleménye.

nem mindegy, hogy :
- csak a vak véletlen
- törvényszerűségek + a vak véletlen...
- irányított véletlen?

Pl :
en.wikipedia.org/wiki/Omega_Point

Nem mindegy, hogy
- good random seed
vagy
- god random seed

egy csónakban 2010.12.09. 11:57:32

@egy csónakban:

>Dawkins, Az önző gén & vak véletlen

A felmérések szerint 2005-ben Magyarországon csak minden 5. ember (kb 20%) hitt a vak véletlenben.
A nagyobb rész valami törvényszerűséget, irányítottságot feltételez.

44% :I believe there is a God
31% :I believe there is some sort of spirit or life force
19% :I don’ t believe there is any sort of spirit, God or life force
6% :Nem válaszolt

ec.europa.eu/public_opinion/archives/ebs/ebs_225_report_en.pdf

Tardi Grada 2010.12.09. 12:23:52

No most eltöltöttem elég sok időt az értem honlapján. Ami lejött:
1. elég nagy ellentmondás van bennük a faj fogalma és a fajkeletkezés kapcsán. Egyrész hozzák, hogy hányféleképpen lehet egy fajt definiálni, de utána egyet sem fogadnak el, ha valamelyik alapján egy kisérletben sikerül kiszelektálni két törzset. Egyébként a fajfogalom körüli hercehurca is azt mutatja, hogy az élőlények egy elmaszatolt térben vannak, nem szép felcímkézett dobozokban.
2. A fitnesz fogalmát lelkesen hanyagolják. Dawkins mondatszelektálós példáját lelkesen kritizálják. (Részben jogosan.) De azzal szembe csak az észnélkül gépelő majmokat állítják. Azt, hogy a szelekció során az adott, sokdimenziós térben élő egyedre mindenképpen nehezedik egy szelekciós kényszer, azt kihagyják. Ez tényleg nem előre adott, hanem a környezet által adott és folyamatosan változik.
3. lehetne sorolni a további elhallgatott dolgokat: neutrális változások lényege, vírusok hatása...

Valahogy egy olyan modellel kéne szembesíteni őket, amiben a fitnesz függvényt a modell aktuális állapota határozza meg és ilyen körülmények között jönnek létre bonyolultabb egyedek. Tudtok ilyen létező modellt? Próbálok keresni ilyet, de ha fejből tudtok akkor segítsetek.

lacalaca · http://cydonia.blog.hu 2010.12.09. 13:20:34

@egy csónakban: rendben, de erről nem népszavazás fog dönteni. Egyébként a hangsúly a másik két felén volt, vagyis a tudomány határainak megsértésén (bár az evolúció tagadása nem is minősül önálló tudományos elméletnek), illetve a viágnézeti deklaráción:

"Neki, mint a szakmájában kiemelkedő molekuláris biológusnak nincs jogosítványa arra, hogy ilyen világnézeti deklarációt állítson fel."

Tehát egy természettudósnak nincs rá deklarációja? Akkor kinek? Az ÉRTEM-nek mitől van? Tasi István antropológus és teológus, vagyis bölcsész, ergo akár foglalkozhat is világnézeti kérdésekkel, de ebből következik, hogy ő még csak nem is természettudós, ergo biológiából erőteljesen kérdéses a kompetenciája, amint az ki is derül abból, amennyit az elvolúcióhoz ért (lásd a gyáras/homokváras példát).

lacalaca · http://cydonia.blog.hu 2010.12.09. 13:31:58

...vagy például egy Bevezetés a statisztikába kurzusra is beiratnám őket, ha ilyet le mernek írni:

"2 . Milyen alapon lehet megállapítani valamiről, hogy vajon tervezték-e? Hogy lehet elkerülni
a szubjektivitást ennek eldöntésekor?

[...]
Tegyük fel, hogy egy barátod átad neked egy papírlapot, amelyre Lincoln Gettysburg-i beszédének
egy részlete van felírva:
"87ÉVVELEZELŐTTAPÁINKEGYÚJSZABADSÁGBANFOGANTNEMZETETHÍVTAKÉLET
REEZENAFÖLDRÉSZEN"
A barátod azt állítja, hogy ez a mondat úgy született, hogy véletlenszerűen a Scrabble (betű-szó-összerakós játék) elemeit húzta ki egy zacskóból. Hinnél neki? Feltehetően nem. De vajon miért nem?
Kételkedésed egyik oka az lenne, hogy állításának valószínűtlensége rendkívül magas. Hiszen olyan sok másféle eredményt kaphatott volna – számtalan lehetséges betűsorozatot –, hogy a fenti mondat véletlenszerű kialakulásának a valószínűsége megközelítőleg nulla.
De nem csupán erről van szó. Ha a barátod az alábbi karaktereket mutatta volna, akkor valószínűleg te is, és mindannyian hinnénk neki.
"LPEÁINTÚŐRÉZBEDBAYGASÁVZAZLAKLEÉ7VSNETÉLMTVTENOZFDEESEHKEÍ8AÖ
ERETGATEJFNTNAZGN"
Miért? Mert egy ilyen betű-szám sorozat kialakulásának nagyobb a valószínűsége. Az első szólánc hasonlít egy felismerhető mintázathoz: egy magyar nyelven leírt mondathoz, szóközök és írásjelek nélkül. A második szólánc viszont nem hasonlít egyetlen felismerhető mintázathoz sem."

.....? Nem szubjektív-e egy betűhalmazt megkülönbözetni azáltal, hogy az emberiség kb 0.2 %-a képes felismerni benne értelmes szöveget? (Amúgy meg, akkor mi van?) 99.8% számára semmi különbség a kettő között! Pont olyan téves "józanészre" támaszkodó vélekedés ez, mint a lottó esetén feltenni, hogy az 1,2,3,4,5 kombináció többször (vagy épp kevesebbszer) nyer.

pounderstibbons 2010.12.09. 13:32:41

@egy csónakban:
Falus András, aki mélyen hívő tudós (jééé, mégsem naturalista minden "evolúció-hivő"?) Dawkins világnézetre vonatkozó kijelentését vitatja, nem pedig tudományos állításait.

Mellesleg Falus András cikkére vajon miért nem ad meg az Értem konkrét linket?

Talán mert ilyenek is vannak benne?

Kérdező:
"– Ön azt mondja, hogy „ne akarjuk lezárni még a tudás folyamatát, és ne akarjuk kizárni Istent a teremtett világból, se bezárni egy fabrikáló, zseniális, hatalmas, erős, halhatatlan mesterember alakjába.” A teremtés és az evolúció egységét hangsúlyozza..."

Falus András:
– Az evolúciót Isten teremtette. Másképp: az evolúció Isten teremtési módszere."

mindennapi.hu/cikk/tudomany/a-hit-altal-az-ember-mindent-megkap/2010-11-04/264

individuum 2010.12.09. 13:33:07

Végigolvastam a(z eddigi) vitát, és most sem lettem az ID híve. De ez az írás a box-ringes hasonlattal szerintem egyáltalán nem elegáns. Értelmezhetetlen allegória, rossz hasonlatok, a vitapartnerrel szembeni lekezelő gőg... Inkább egy szektára jellemző hozzáállás, és nem egyeztethető össze a szkeptikusoktól (tőlem) elvárt szellemi nyitottsággal.
Aki elolvassa a vitát, az minden további nélkül képes értelmesen mérlegelni az érveket (vagy azok hiányát), semmi szükség a vitapartnert dehonesztáló érzelmi ráhangolásra.

Pandit 2010.12.09. 13:35:21

"Neki, mint a szakmájában kiemelkedő molekuláris biológusnak nincs jogosítványa arra, hogy ilyen világnézeti deklarációt állítson fel."

Gyanítom arról lehets szó, hogy a "nincs jogosítványa arra" fordulat nem túl szerencsés.

Talán úgy akarta érteni, hogy a nem elég határozottan választotta szét mi a tudományos és mi a világnézeti kérdés/válasz, és nem tette kellően világossá, hogy a tudományos munkájában szerzett ismeretanyag/tekintély nem teszi őt kompetensebbé egy világnézeti megállapítás megfogalmazásában. Pont akkora "jogosítványa" és kompetenciája van mint bármelyikünknek akik mondjuk a biológiához nem sokat konyítunk.

Cypriánus 2010.12.09. 13:36:28

halkan megjegyezném, hogy a neodarwini szintézis (genetika+evolúció) egyik atyja, az amerikai-ukrán Theodosius Dobzhansky,(Feodoszij Dobzsanszkij) aki azt mondta, " a biológiában semminek sincs értelme ami nem magyarázható az evolúcióval", nos Dobzhansky minden vasárnap a "Goszpodi pomiluj" -t énekelte gyertyák és ikonok közt, ugyanis hívő pravoszláv volt....(a másik neodarwini atya meg mellékesen anglikán )

a teremtés -ami egyáltalán nincs az antik vagy keleti vallásokban, az nem teremtés-egy nagyon is speciálisan zsidó-keresztény (majd átvétellel iszlám) dolog , mely alapvetően ontológiai kérdést feszeget. Ha a természettudós lételmélettel foglalkozik (ami filozófiai kérdés, tehát nem mérhető vagy kisérletezhető) , ugyanúgy eltévedt, mint ha teológiai köntösben akarunk természettudományt űzni.
Magam 100% hardcore evolucionista vagyok és 100% hardcore katolikus keresztény. ...és nincs a kettő közt ellentmondás. (Sorry, de ahogy John Lukacs mondta, őt XX. századi katolikusként azért fárasztotta a daytoni majomper, mert nem a "haladás ütközött a modernséggel" hanem XVII. század a XIX.-századdal...a felvilágosodás bukott racionalista eszmerendszere legalább annyira hiteltelen és fárasztó, mint a neoprotestáns evolúciótagadók, csak az utóbbiaknak legalább van pozitív társadalmi vetületük. :-) )

Pandit 2010.12.09. 13:36:30

Persze jó volna tudni mi is volt az az állítás amit "világnézeti deklarációnak" nevezett, de erre most nincs időm.

Cypriánus 2010.12.09. 13:38:11

mármint "haladás és modernség ütközött a középkorral" , bocsi, elírtam.

Pandit 2010.12.09. 13:38:48

@Cypriánus:
Egyetértek. Én sem látok semmilyen ellentmondást.

egy csónakban 2010.12.09. 13:45:28

@lacalaca:

>(bár az evolúció tagadása nem is
> minősül önálló tudományos elméletnek)

Falus András szerint ugyanilyen logika alapján az "isten tagadása" se minősül önálló tudományos elméletnek.

------

>Tehát egy természettudósnak nincs rá deklarációja? Akkor kinek?

szerintem csak egyszerűen arról van szó, hogy a hit és a tudomány összekeverése egyik oldalon se optimális. erre akart (jogosan) célozni F.A.

egy csónakban 2010.12.09. 13:56:57

@pounderstibbons:

>"Falus András:
>– Az evolúciót Isten teremtette.
> Másképp: az evolúció Isten teremtési
> módszere."

érdekes rekurzió ..
vagyis az Evolúció az ID része.

Tardi Grada 2010.12.09. 14:09:59

@individuum: Igazad van. Én is kissé falsnak érzem a hangvételt. Ilyen stílusban pont az ID hívők szoktak előadni és pont akkor, amikor a legnagyobbakat csúsztatják. Szóval nem kéne lecsúszni az ő szintjükre... :)

pounderstibbons 2010.12.09. 14:13:21

@egy csónakban:

Ahogy Cypriánus is megállapította, az evolúció és szinte bármilyen vallás békésen megférne egymással.

Akár mondhatnák is Tasiék, hogy az ID-nek a részeleme az evolúció, de akkor nem lehetne megkülönböztetni az Értem-et, egy olyan hittanórától, ahol eltitkolják, hogy melyik vallás képviseletében tartják...

Pandit 2010.12.09. 14:25:19

@pounderstibbons:
"Akár mondhatnák is Tasiék, hogy az ID-nek a részeleme az evolúció, de akkor nem lehetne megkülönböztetni az Értem-et, egy olyan hittanórától, ahol eltitkolják, hogy melyik vallás képviseletében tartják... "

Ha jól értelek ez azt jelenti, hogy az értem szeretné eltitkolni hogy nem tudományról, hanem tulajdonképpen "tudományos babérokra" vágyó világnézetről van szó?
Én mindenesetre tökéletesen szánalmasnak találom őket, különösen ezzel az "Őrtoronyra hajazó" honlap dizájnal és zárt belső világgal (se komment se korrekt hivatkozások.)

Gallis Deece 2010.12.09. 14:30:40

@pounderstibbons:
Igen, abban az esetben, ha hajlandó vagy becsapni magad, és azokat, és másokat, hogy ez az "evolúció" egyenlő az evolúció tudományos elméletetével.

Például:
Fekete Ágnes: Azért az, ahol én is megakadok, az ember. Azt mondani, hogy a majomból lett az ember, számomra elképzelhetetlen.

Falus András: Az igazi evolúció elmélet ezt soha nem is állította. Ez a vulgár-materialista felfogása valaminek, aminek idealisztikus háttere van.
www.evangelikus.hu/lapszemle/falus-andras-akademikus-evoluciorol-es-teremtesrol

Falus András:A vulgármaterializmussal a "vulgárteológia" áll szemben. Az evolúció a genetikai változások összessége, a teremtett világ sokfélesége, Isten "teremtési módszere". Törvényeit Isten teremtette. A "majomős"-koncepciónak semmi köze sem a valósághoz, sem a tudományhoz.
5mp.eu/web.php?a=lelkigondozas&o=dhQNPD9s5L

Azért, mert Falus András "evolúciónak" nevezi a saját kreacionizmusát, ne essünk már hanyatt tőle.

maycontainnuts 2010.12.09. 14:47:43

@Tardi Grada:
@individuum:

Ha falsnak tűnik a stílusa miatt a cikk, az azért (is) lehet, mert igyekeztem részben visszaadni az ID cikkeinek elfogultságoktól terhelt lendületét, és ti ezt a stílust inkább az ID-vel rokonítjátok.
Ha teljesen az ő stílusukat venném át, akkor mindenféle népirtásokkal és történelmileg szégyenletes államrendszerekkel hoznám őket összefüggésbe, ahogy ezt ők is szokták (alaptalanul) az evolúcióelmélet kárára.

Velük ellentétben azonban felkínálom a lehetőséget, hogy mutassanak rá, hogy hol állítok valótlanságot. Szándékosan biztos nem csúsztattam, de tévedések elképzelhető, hogy vannak a szövegben.

Ezzel szemben, amikor ismerőseim próbáltak az ID fórumain megnyilvánulni (már ahol egyáltalán lehet), a legenyhébb kritikát is azzal zárták le, hogy az adott vélemény csak moderálást követően fog megjelenni. És ez a moderálás több, mint egy éve is várat magára...

Az, hogy nem megyünk le az ő szintjükre, az pedig azt eredményezheti, hogy egy elég jelentős legalább annyira érzelmeire, mint tudására hallgató csoportot nem vagyunk képesek megszólítani.
A cikk nem azoknak készült, akik ismerik (és értik) az evolúcióelméletet, de esetleg nekik is hasznos lehet, mert harmadannyi karakter csak, mint az eddigi vita.

A bokszmeccs allegória lehet, hogy szintén fals, de nem jutott jobb eszembe,viszont másnak is leginkább ez ugrott be a vitáról:
szkeptikus.blog.hu/2010/11/05/kulturalt_vita_az_evoluciorol_es_az_intelligens_tervezettsegrol/fullcommentlist/1#c11814126

Javaslatokat jobb metaforára elfogadok.

Akinek pedig ez a cikk nem megfelelő stílusú, az ugorjon gyorsan a vitára és hagyja nyugodtan a cikket figyelmen kívül.

Tardi Grada 2010.12.09. 14:55:23

@maycontainnuts: azt nem állítottam, hogy csúsztatsz! :) Csak rossz emlékek jöttek elő a stílustól. Egyébként a vitát végigolvastam. Nagyon tanulságos. Szóval nagyon örülök ennek a vitának és hajrá. Szurkolok...

egy csónakban 2010.12.09. 14:55:29

@Gallis Deece:

>Azért, mert Falus András "evolúciónak"
> nevezi a saját kreacionizmusát, ne
> essünk már hanyatt tőle.

Tedd hozzá, hogy F.A "saját kreacionizmusa" összeegyeztethető a Tudománnyal.

Nem Tudomány ellenes.

ahogy Schrödinger "saját kreacionizmusa" se Tudomány ellenes.

MosoMasa 2010.12.09. 14:57:48

Én nem teljesen értem, mi a különbség a Értelmes Tervezettség és az "isten teremtette világ" között.
Mert nekem látszólag semmi.

pounderstibbons 2010.12.09. 15:05:34

@Gallis Deece:
Az nem tetszik nekem se, hogy Falus A. nem fejti ki mindig, hogy a majom-ős felemlegetése miért hamis.

Mert ha hozzátenné, hogy az ember nem a majomtól származik, hanem az embereknek és majmoknak volt közös őse, akkor szabatos és tudományos választ adna.

De az lehet, hogy megint megrettentené a közönségét, ezért elhagyja, vagy úgy véli hogy mindenki tudja, ezért hagyja el.
Nem vagyok értelmes tervező, nem látok Falus A. fejébe.

@MosoMasa:
Ők azt mondják, hogy nem tudják ki a Tervező, de nem is érdekli őket.(pedig dehogynem...)
Az is lehet, hogy a Katolikus vagy Lutheránus Isten, lehet, hogy Jehova, lehet az Olümposziak, lehetnek a védikusak. Sőt, lehet Ufó is. Vagy papucs orrán pamutbojt.
De VALAKI!
Jah és bizonyíték pont annyi van erre mint az előbb felsoroltakra.

egy csónakban 2010.12.09. 15:10:05

> Én nem teljesen értem,
> mi a különbség a Értelmes
> Tervezettség és az
> "isten teremtette világ" között.

az igazi fő kérdés ..
Te mit értesz Isten alatt?
en.wikipedia.org/wiki/God

és nem biztos, hogy F.A vagy akár T.I ugyanazt érti alatta. Sőt lehet, hogy az ő nézetük is eltér ..

És a bónuszkérdés ..
- Mi az Élet értelme? ( és itt nem a 42-re gondoltam )

Gallis Deece 2010.12.09. 15:11:42

@egy csónakban:

>>Falus András: A "majomős"-koncepciónak semmi köze sem a valósághoz, sem a tudományhoz.<<

Azt azért elmondhatnád, hogy ebben mi a tudományos, tekintve, hogy a csimpánz, gorilla és az ember ma is majmok (=ape), és ősei is majmok (monkey) voltak.

Érdekes módon Falus nem fejti ki bővebben, hogy akkor mik voltak az ember ősei, ha voltak szerinte egyáltalán...

Továbbá: az irányított evolúció még mindig nem az evolúció tudományos elmélete.

@pounderstibbons:
"De az lehet, hogy megint megrettentené a közönségét"

Igen, az pedig, aki Falust ünnepli, hogy "lám, lám, összeegyeztethető", ugyanúgy megvezeti a közönséget a tudománnyal kapcsolatban a PC kedvéért, mint Falus.

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 15:21:33

hajrá hívők, vessétek mágjára a teremtéspártiakat!!

ki látott már olyat, hogy egy dolgot a létrejötte előtt megterveznek?
ennek semmi értelme!

pounderstibbons 2010.12.09. 15:21:59

www.diffen.com/difference/Ape_vs_Monkey

Én nem olvastam olyat Falustól, hogy valaki irányítaná az evolúciót. Azt hogy Isten létrehozta, olyat igen.

Ami viszont bizonyíthatatlan. Mondhatnánk illegális határátlépő ebben az esetben Falus A. ha ezt tudományos ténynek tartja. :)
Ha nem, akkor van egy véleménye ami nem egyezik a tiéddel. Meg pl. az enyémmel se, de még vannak így ezzel néhányan.

Gallis Deece 2010.12.09. 15:23:25

Köszönöm, hogy nem szóltok hozzá wmikihez!

pounderstibbons 2010.12.09. 15:25:32

@wmiki:
Mikike koncentrálj a fórumodra inkább, mert megint hangosan akarok kacagni!

Wmiki bemutatja:
"Miért párolog a víz, amikor a tudomány szerint azt neki nem szabad!" c. önégetését:

forum.szkeptikus.hu/viewtopic.php?f=8&t=239

Gallis Deece 2010.12.09. 15:28:16

@pounderstibbons: "Mondhatnánk illegális határátlépő ebben az esetben Falus A"

Nos, igen, intellektuálisan nem éppen őszinte dolog, hogy minden harmadik mondata az, hogy "Isten teremtette az Evolúciót!", aztán meg beszól Dawkinsnak (aki mellesleg nem molekuláris biológus, mint Falus mondja, hanem zoológus...), hogy hogyan merészel világnézeti következtetést levonni a megfigyelt jelenségekből.

egy csónakban 2010.12.09. 15:32:29

@Gallis Deece:

> Továbbá: az irányított evolúció még
> mindig nem az evolúció tudományos
> elmélete.

A "vak véletlen" az?
Hogyan lehet megállapítani, hogy valami tényleg "vak véletlen"?

Gallis Deece 2010.12.09. 15:34:30

@pounderstibbons:

"Én nem olvastam olyat Falustól, hogy valaki irányítaná az evolúciót. Azt hogy Isten létrehozta, olyat igen."

@egy csónakban: A "vak véletlen" az?
Hogyan lehet megállapítani, hogy valami tényleg "vak véletlen"?

A különbség minimális, egyik állítás sem ellenőrizhető, tudományos szempontból teljesen üres állítás, továbbá az intellektuálisan őszinte válasz az, hogy sem irányításnak, sem beindításnak semmi nyomát nem találjuk.

Ugyanannyira érvényes elmélet, mint Krisna, vagy az Utolsó Csütörtökizmus.

Gallis Deece 2010.12.09. 15:36:17

@Gallis Deece:
jav:
"A különbség minimális," > az irányított és a beindított között, ha nem fogalmaztam elég világosan.

Art Mooney 2010.12.09. 15:36:21

pont olyan ellenszenves és ostoba húzás, amikor a tudomány nevében szólnak bele a hitbe, mint amikor régen a hit nevében szóltak bele a tudományba.

Gallis Deece 2010.12.09. 15:38:50

@egy csónakban:

Ugye nem kell elmondani, hogy az evolúció nem a "vak véletlen" elmélete? Ugye nem játszunk Jeszenszky "az evolúció kérdése az a csatatér, ahol ma Isten seregei és a Sátán seregei megütköznek" Ferencet, és megértjük, hogy a természetes szelekció nem véletlen folyamat? Ugye?

lacalaca · http://cydonia.blog.hu 2010.12.09. 15:39:01

@egy csónakban: igaz, igaz, nekem csak az böki a csőrömet, hogy ez az idézet így ki van forgatva a honlapon... Hiszen a tervező feltételezése az élő szervezetek mögött ponthogy világnézeti kérdés.

@Gallis Deece: agreed. :D

midnight coder 2010.12.09. 15:39:11

Mondjuk szvsz az evolúcióban mint lehetőségben hülyeség kételkedni, elvégre mi is használjuk évezredek óta - ezt hívjuk nemesítésnek, háziasításnak, tenyésztésnek.

Az megint egy másik kérdés, hogy maga a DNS és ez az egész mechanizmus kialakulhatott-e random módon úgy hogy nekiállunk kevergetni pár szerves anyagot. Jó, tudom elég sok idő állt rendelkezésre, ugyanakkor azért elég kevés olyan hely lehetett anno a földön ahol hosszabb ideig kellő mennyiségű ilyen anyag halmozódott fel. Mondjuk, ha valaki produkálna valami olyat egy lombikban hogy pár random, a világürben illetve a korabeli Földön előforduló anyag kotyvasztásával előáll valami DNS-lánchoz hasonló, önreprodukcióra képes rendszer, akkor már _sokkal_ meggyőzőbb lenne a dolog.
Aztán az is lehet, hogy valaki itt-ott beavatkoztak később is. Ezt utólag sem cáfolni, sem igazolni nemigen lehet. De ha mi meg tudjuk tenni, mások is megtehették.

KenSentMe 2010.12.09. 15:42:38

@pounderstibbons:
Ezt az általad linkelt fórumon találtam és nagyon röhögtem rajta, muszáj lájkolnom és retwittelnem:

"wmiki - a tudományos ignorancia mértékegysége. Mivel az 1 wmiki túl nagy egység, ezért általában a piko- fempto- és attowmiki formát használjuk.
(Hraskó Gábor)"

fordulo_bogyo 2010.12.09. 15:43:27

@MosoMasa: "Én nem teljesen értem, mi a különbség a Értelmes Tervezettség és az "isten teremtette világ" között.
Mert nekem látszólag semmi. "

Jogi kulonbseg van koztuk. Az USA-ban az allam es az egyhaz szigoruan szet van valasztva, igy allami iskolaban nem tanithato az isteni teremtes, ezert istent elhomalyositottak, elmaszatoltak a sztoriban.
Az Ertelmes Tervezo egy elhomalyositott, szetmaszatolt Isten.
Nem veletlen, hogy semmit nem hajlando az ID/ERTEM kijelenteni a tervezorol, azt, hogy isten nem mondhatjak, mert akkor eljatsszak az eselyt arra, hogy az USA-ban tananyagga valjanak, mast meg nem akarnak mondani, mert iagazabol istent gondolnak.

Gallis Deece 2010.12.09. 15:49:15

@pounderstibbons:
"Én nem olvastam olyat Falustól, hogy valaki irányítaná az evolúciót. Azt hogy Isten létrehozta, olyat igen."

1) Ugye egy mindentudó Isten esetében (aki az evolúció teremtés közben pontosan tudja, hogy az hogyan fog alakulni) ez a megkülönböztetés teljesen felesleges.

2) "Azt hogy Isten létrehozta, olyat igen." > Ugye ez megint egy God Of The Gaps érvelés, pont mint a baktérium ostora. csak -ismét- Falus az ő saját God Of The Gaps kreacionizmusát "evolúciónak" hívja, ezért mindenki el van tőle ájulva, hogy "Lááám, kompatibilis!" Ehh.

Link Elek 2010.12.09. 15:54:30

csodalom azokat, akik Sámánokat megprobalnak meggyozni, hogy nem a láthatatlan egyszarvuak szarták a fényt.
eleg remenytelennek tunik. a legtobbjuk logikus gondolkodasra teljesen keptelen.

Nem lenne eleg az okotatasi kormanyzatra koncentralni?

Gallis Deece 2010.12.09. 16:00:32

@pounderstibbons:
"Az nem tetszik nekem se, hogy Falus A. nem fejti ki mindig, hogy a majom-ős felemlegetése miért hamis."

1) Mert nem hamis. Az embernek volt majom őse. Ugyanúgy volt hal őse is. Továbbá: a magyar "majom" szó pedig ugyanúgy vonatkozik a csimpánzra, gorillára is, mint a makákóra. Ha pedig a csimpánz és a gorilla majom, akkor az ember és a csimpánz közös őse is majom. Ergo: itt sem játszik a "nem volt majom-ős".

2) "De az lehet, hogy megint megrettentené a közönségét, ezért elhagyja"
Akkor nem tudományos ismeretet közöl, hanem apológiát végez, ennek rendeli alá és magyarázza félre a tudományos tényeket. Ezért egy elvileg tudománynépszerűsítő fórumon hagy ne dicsérjük már meg.

maycontainnuts 2010.12.09. 16:06:13

@fordulo_bogyo:
Stimmel.

@Link Elek:
Jövőnk oktatási kormányzata (nem az enyém, de a gyerekeimé, unokáimé) ott ül az internet előtt és blogokat olvas. Ha csak az ID-vel találkoznak ott, akkor mégis hogyan lehet őket befolyásolni?

ui: Amerikában most jelöltek az Energiaügyi Bizottság élére egy John Shimkust, aki szerint a klímaváltozástól azért nem kell félni, mert Noénak meg lett ígérve, hogy több globális katasztrófa nem lesz.

www.juancole.com/2010/11/energy-committee-chairman-candidate-says-god-promised-no-more-catastrophic-climate-change-after-noah.html

Örülnék, ha Shimkus felebarátom belefutott volna néhány blogba, vagy legalább könyvbe a témában.

lacalaca · http://cydonia.blog.hu 2010.12.09. 16:08:55

@fordulo_bogyo: így van, csak kreacionizmus nélkül nem marad más, mint az evolúció támadása és valami homályos próbálkozás a nem-isten-csak-felsőbb-tervező nyomainak kimutatására, ami meglepő módon az evolúció ekézésével történik. Kör bezárva.

Gyakorlatilag ez az "God of gaps" vagyis lyukak istene szemlélet: valami túl bonyolultnak és/vagy megmagyarázhatatlan(nak tűnik), akkor hoppsz előugrik a válasz: Isten/tervező/stb. Van egy jó előadása erről Neil deGrasse Tysonnak:
www.youtube.com/watch?v=0vrpPPV_yPY
aki szépne végigviszi, hogy pl:
1. ókori görögök nem értették, miért úgy mozognak a bolygók, ahogy -> felsőbb hatalom, kvintesszencia, stb.
2. Newton megfejtette, hogyan működik a gravitáció -> AZ mozgatja a bolygókat. De! megpróbálja kiszámolni, hogy a Naprendszer égitestjeinek egymásra hatása miatt stabil-e a rendszer? Nem tudja -> Isten így alkotta meg.
3. Aztán persze kiszámolták (Laplace et al), hogy a Naprendszer stabil kellően hosszú ideig -> a teremtő megint hátrébb szorult, az aktuális tudás határához.

Csak hát ha azt mondjuk, hogy idáig tartott a tudomány, innentől nincs tovább, mert az már felsőbb hatalom, természetfeletti, úgysem lehet megfejteni, fogadjuk ezt el, akkor a fejlődésünk beleáll a földbe. Mi lenne a ötven éve azt mondták volna, nincs tovább, ez már túl bonyolult, ez már megfejthetetlen? Száz éve? Kétszáz? Csak azért mert valamit nem értünk vagy nem illeszkedik a világképünkbe, nem kell feltartani a kezünket: inkább az ingujjat kell feltűrni, és tovább kutatni.

mostmar_kicsit_unom 2010.12.09. 16:12:42

komolyan srácok, én nem értem, hogy mi értelme van vitázni velük. az igazi vita még csak meg nem valósulhat, hiszen alapvető dolgokban sem lehet velük megállapodni. egyszerűen nem hajlandóak logikusan gondolkodni.
valójában a józan ész és kongitív disszonancia harca ez.

lehet, hogy viccesek közben, meg minden, de azért még a megalázás se vicces egymás után sokszor...

de azért idézek egy régi-régi beszélgetést egy kreacionista, és egy gondolkodó ember között.

kr.: - Éséssés a dinószaúruszokat is csak úgy összepakolják a tudósok, a csontjaikat, mint a puzzle-t! Nem is dinószaurusz az, hanem csak amit a földben találnak, kis csontok!

ge.: - Igazán? Hát ez felvet egy érdekes kérdést...

kr.: .... ?!?

ge.: Honnan szereztek koponyát...?

kr.: .... X/ ... oO ... :| ... '''syntax error'''

Peter T. Sinclare 2010.12.09. 16:15:34

@lacalaca: Hibás az ellenérved. Nem kell tudnod az adott nyelven, hogy felismerd, értelmes írással van dolgod. Ehhez ugyan nyelvészetet kell tanulj, de éppen itt hibás az ellenérved: az, hogy az emberiség 99,8%-a tanulatlan, nem az a 0,2% téved!

gattcatggagagaaaggtcttccgag

Mennyire értelmetlen, igaz? Pedig egy genetikus számára ez pont olyan - bár jelen sor véletlenszerű, vedd úgy, kimásoltam egy létező DNS egyik szekvenciájának kis részét -, mint az általad idézett első karaktersorozat. Aki tudja, mit keressen, az fel tudja ismerni a különbséget értelmes és értelmetlen között.

Peter T. Sinclare 2010.12.09. 16:18:50

@lacalaca: Vegyétek úgy, én egy harmadik csoportot képviselek, tehát se evolucionista, se kreacionista nem vagyok.

A Lyukak Istene egyébként az ID-ben sem feltétlen nyerő.

Az evolúció esetében felismerhető tendenciák miatt kizárható a vak véletlen, és elvethetők Dawkins főbb állításai is. A természetes kiválasztás nem a legfőbb törvénye, ahogy nincs önző gén sem.

pounderstibbons 2010.12.09. 16:19:57

@Gallis Deece:

Dehogy dícsérem én ezért.

Falus A.-nak szerintem van egy a tudomány jelen állásával összeegyeztethető világképe, mert az ismert evolúciós lépéseket nem vonja kétségbe. A nem ismertekkel kapcsolatban meg mindenki olyan hipotézist állít fel, amilyet csak akar.

Majd ha előkerülnek azokkal kapcsolatos bizonyítékok is, akkor eldől, hogy Falus A. tovább hátrál a szűkülő lyukak felé, vagy vitába száll a bizonyítékokkal. De lehet, hogy az Ő hitének megfelelő cselekmények annyira távoliak, hogy a mi életünkben már nem kerülnek elő azokkal kapcsolatos bizonyítékok.

Meg még az is előfordulhat, hogy megtalálják a 4 milliárd éves, "XENU itt járt!" feliratú 60*40 kilométeres bazalttáblát a hold túlsó oldalán, és akkor tényleg át kell írni a tankönyveket.

Addig viszont hagyják azokat békén!

Peter T. Sinclare 2010.12.09. 16:24:17

@Gallis Deece: Az első pontodra: a mindentudás olyan teológiai probléma, amiről talán akkor nyilatkozz, ha rendelkezel teológiai ismeretekkel ;) a mindentudás egyébként nem egy vallás istenére vonatkozik csak, tehát itt jön be a vallásismeret.

Egy alternatív magyarázat a mindentudásra, tőlem, neked:
Azt jelenti, hogy az istenség minden lehetőséget, csomópontot, elágazást tud előre. Ez elviekben nem zárja ki az evolúciót, vagy a fajváltozást: minden lehetőséget ismer, de nem szól bele, melyik valósuljon meg ténylegesen.

pounderstibbons 2010.12.09. 16:28:05

@Peter T. Sinclare:

"Vegyétek úgy, én egy harmadik csoportot képviselek, tehát se evolucionista, se kreacionista nem vagyok."

Akkor mondhatjuk, hogy ID-s vagy?

Ezen esetben, tegyük fel a vita kedvéért, hogy bebizonyítod, hogy pl. az első élőlény (bár még nem találtuk meg) DNS-e tervezett. Mennyivel vagyunk akkor előrébb?

lacalaca · http://cydonia.blog.hu 2010.12.09. 16:28:58

@Peter T. Sinclare: az igaz, az emberek képesek mintákat felismerni. Speciel az a jó a nyelvben, hogy egy halom más változatban is felismerhető az a mondat (pl betűpárokat megfordítva), hála az agyunk hibajavító képességének, vagyis messze nem egyetlen jó kombináció van. És itt jön be a statisztika: minden kirakott mondat esélye ugyanakkora, a kérdés az, hány százalékban kapsz olyan eredményt, amit értelmezni vagy képes. Pláne, hogy ennyi betűből rengeteg anagrammát is létre ehet hozni, értelmes mondatokat is. Vagyis messze nem egyetlen értelmes szólánc áll szemben milliónyi másikkal, annál sokkal összetettebb a helyzet.

Egyébként igen, felismertem, hogy DNS-szakasz, de például ennél több értelmet egyáltalán nem biztos, hogy akár egy genetikus képes mögé tenni. Ez most olyan, hogy az ékezetes betűkről meg ki lehet találni, hogy mindegyik betűsor magyar ábécét használ, és akkor meg hirtelen P=1.0.

lacalaca · http://cydonia.blog.hu 2010.12.09. 16:33:56

"A természetes kiválasztás nem a legfőbb törvénye, ahogy nincs önző gén sem. "

Ilyet senki sem állított, én, mint nem-biológus tudok mondani mást is, szabad élettér betöltése például igen erős szabály, ahogy a földrajzi szeparáció is, hát még a kettő együtt. Lásd puma-tigris-oroszlán-jaguár, azonos őstől földrajzilag szeparáltan kifejlődött, de azonos fülkét kitöltő fajok.

BTW, a legtöbb emlősnek (incl ember) visszavezethető a vonala a pár, dínók lábai között szaladgáló egérszerű izére, szóval ennyit a majomősről.

mostmar_kicsit_unom 2010.12.09. 16:34:24

@pounderstibbons: aki új szóösszetételeket alkot, két csoport közötti harmadik "egyikhezsemtartozom", stb az mindig, MINDIG gyanús... :D

Peter T. Sinclare 2010.12.09. 16:35:34

@Gallis Deece: a természetes kiválasztással az a probléma, hogy nem ad választ sem az eltérő evolúciós sebességre, sem arra, miként lehetséges, hogy az evolúció miért az értelmesebb fajoknak kedvez - egy dínófaj sokkal kisebb eséllyel él túl egy globális kataklizmát, mint egy baktérumfaj.

A következő tendenciák bizonyosan megfigyelhetők az evolúció során:*
1. egyszerűbbtől az összetettebbig (komplexitás tendenciája)
2. primitívebbtől az értelmesebbig
(intelligencia tendenciája)
3. egyedülállótól az ökoszisztémáig
(rendszer tendencia)
4. függőtől a függetlenig
(önfenntartás tendenciája)

*: nem lineáris a fejlődés. Néha gyorsabb, néha lassabb, vannak visszafordulások, stb. de a végeredmény mégis folyamatos fejlődés.

KenSentMe 2010.12.09. 16:36:53

@lacalaca: @Peter T. Sinclare: Az a baj az értelmesség felismerésével, hogy az ember maga is értelmes lény, és amint elkezd valamiben értelmet keresni, nagyon könnyen megtalálja az adott dologban azt az értelmet, ami igazából a saját fejében létezik (ez valami olyasmi, mint amikor egy költő ráismer a viharban a saját szomorúságára és bánatára, csak ezt az értelem keresői nyilván sokkal nagyobban játszák).

Az, hogy én felismerem egy random sorozatban egy általam értelmesnek tekintett szöveg részletét, vagy egy genetikus felismeri egy random g-a-t-c sorozatban egy dns szekvencia kódját, attól az a random sorozat nem válik tervezetté. Sajnos az én szubjektív tudásom kérdése, hogy mit látok bele. Továbbmenve: egy omnipotens, mindenről mindent tudó, minden nyelven beszélő, minden kódolást ismerő lény szinte minden random karaktersorozatba belelát valami értelmeset. (Ahogy egy frappáns és okos ember is bármiről tud írni valami érdekeset szinte.)

Amúgy lehetne ebben a kérdéskörben izgalmas példákat kitalálni. Például, ha random scrabble közben kijönne egy olyan sorozat
hogy TEJVEZETMUSKATLIDEMOKRACIABOLCSAVARHALALKVARTETT, akkor most ezt hogy ítéljük meg? Tervezett, mert magyar szavak kerülnek elő benne, vagy véletlenszerű, mert az egésznek se füle, se farka?

Arról már ne is beszéljünk, hogy sokmilliárd évnyi véletlen betűvetés alatt valóban előfordulna egyszer egy viszonylag hosszú, értelmes szöveg, és ebben semmi csoda vagy tervezettség nem volta, egyszerűen így működik a véletlen. Ahogy abban sem volna semmi tervezettség, ha most felemelkedne a szék a szobámban, és tenne egy kört a levegőben. A kvantumfizika ezt lehetővé teszi, még akkor is, ha elképzelhetetlenül kicsi a valószínűsége.

Gallis Deece 2010.12.09. 16:37:25

@pounderstibbons:
Falus A.-nak szerintem van egy a tudomány jelen állásával összeegyeztethető világképe, mert az ismert evolúciós lépéseket nem vonja kétségbe.

Erről ugyan nem vagyok meggyőződve, de munkahipotézisnek fogadjuk el.

Ebben az esetben a hipotetikus Falus-féle evolúció pontosan ugyanannyira kompatibilis "az" evolúcióval, mint pl. az Utolsó Csütörtökizmus. = Ugyan semmi nem szól ellene, de 0 bizonyíték van rá.

A PC jegyében Falust kirakatba tenni, mint "lám, lám, kompatibilis", és nem megemlíteni a ténynek a második felét, miszerint bármilyen természeti jelenségre az mondani, hogy "Isten csinálta", az ebben az értelemben kompatibilis a tudománnyal, az intellektuálisan őszintétlen.

Peter T. Sinclare 2010.12.09. 16:41:01

@pounderstibbons: ne vedd úgy. Nem vagyok ID-s, mivel az én felfogásom szerint a természetes folyamatokba beavatkozások történnek, de azokat nem irányítja senki.

Mondjuk úgy, én a lehetőségek Istenében hiszek, nem a tervező Istenben.

Tehát a kérdésedre is csak a saját felfogásom alapján válaszolhatok: a DNS, mint olyan egy "belenyúlás" eredménye, amely által az élettelen világban megjelenhetett az élet. Maga az a hihetetlenül egyszerű, mégis rendkívül hatékony, életkódoló információt tároló- és végrehajtó egység, ami a DNS - suta megfogalmazás, tudom -, számomra azt bizonyítja, hogy történt közbeavatkozás. De azt nem, hogy bárki eltervezte volna, milyen fajok jöjjenek létre.

Gallis Deece 2010.12.09. 16:41:17

@Peter T. Sinclare: "minden lehetőséget ismer, de nem szól bele, melyik valósuljon meg ténylegesen."

szóval akkor tudja, hogy mi fog történni, vagy nem. mert ha a csomópontnál nem tudja, hogy mi fog történni, akkor nem mindentudó. Ha tudja, akkor nincs szabad választás. QED

Azt meg még meg sem említettük, hogy elvileg ez az Isten az időn kívül van, szóval LOL.

Ennyit a kifinomult teológiádról.

nick_50plus 2010.12.09. 16:41:33

@VRbagoly: hello, a 'wmiki' parolgasi dolgokat vegigolvastam. Kosz, hogy ratalaltam. Igazan jol is szorakoztam, de inkabb elszomoritott, hogy az oktatas rendszere ilyen eredmenyeket produkal...

(not_just_my)_one_and_only_rule 2010.12.09. 16:47:21

Én csak azt nem értem, hogy egy ilyen vitának mi az alapja?

Az evolúciós elmélet természettudományos elmélet? - Igen.
Az értelmes tervezettség természettudományos elmélet? - Nem.

Miről beszélünk? A természettudományos elméletek egyebek mellett többször ellenőrzött megfigyeléseken alapulnak, bizonyítékok támasztják alá, és ami az egyik legfontosabb, többé-kevésbé pontosan meghatározható módon CÁFOLHATÓ.

Az értelmes tervezettség egyik feltételt sem teljesíti, és bár lehet hadoválni, hogy az első kettőt esetleg mégis (persze nem), az utolsó pontot nyilván soha nem fogja.

Semmi bajom, ha az értelmes tervezettséget tanítani akarják - hittan órán. Ott a helye.

Peter T. Sinclare 2010.12.09. 16:47:43

@pounderstibbons: A kérdésedre előbb nem válaszoltam. "Mennyivel vagyunk előrébb"?

Például azzal, hogy a saját világképem saját magam számára kielégítően egyesíti a tudomány eredményeit az istenhittel. Csak én más modellt alkotok, mint egy evolucionista ugyanabból a ténykészletből.

De globálisan válaszolva: Dawkins teljesen kiborult a saját modelljétől, mert az ő élete a saját elmélete szerint: semmi. Csupán néhány önző gén hordozója, egy önösszeszerelő automata, amelyre igaz, hogy az egészt alárendelték a résznek, és élete egyetlen valódi értelme, hogy a génjei továbböröklődjenek.

Ezek alapján Hitlernek, meg az őt megelőző kaliforniai tudósoknak volt igazuk: az eugenetika jó dolog.

gyaloghartur 2010.12.09. 16:48:07

Tudatlannak véletlen minden:
nem OK, nem TEREMTŐ az Isten.
A Tudósnak véletlen minden:
nem OK, nem TEREMTŐ az Isten.

Tudatlannak bizonyság Isten:
csak őtőle származhat minden.
Tudósnak bizonyság: kell Isten,
csak őtőle származhat minden.

Tudatlannak higgyetek, mintsem hirdessem fennen nincsen Isten!
Vagy Tudósnak higgyetek , mintsem
hirdessem, hogy véletlen sincsen...

Peter T. Sinclare 2010.12.09. 16:50:48

@Gallis Deece: nem QED mert rosszul vezeted le.

Tudja az összes lehetőséget, csomópontot, elágazást. Van valódi választás, mivel nem kényszerít választásra.

A fizika törvényei sem korlátoznak a szabad akaratodban: bármire törekedhetsz. De ettől még ha bevered a fejed a falba, bizony fájni fog a kobakod ;) Ám törekedhetsz arra, hogy felfedezd, miként nem fog fájni a fejed, ha a falba vered. És meg fog születni, mondjuk, a bélelt, kompozit műanyag bukósisak :)

Peter T. Sinclare 2010.12.09. 16:52:13

@gyaloghartur: tetszik :)

másként mondva:
egy hívőnek minden lehet bizonyíték.
egy hitetlennek semmi sem lehet bizonyíték.

Gallis Deece 2010.12.09. 16:53:58

@Peter T. Sinclare: "Ezek alapján Hitlernek, meg az őt megelőző kaliforniai tudósoknak volt igazuk: az eugenetika jó dolog."

És a a gravitáció az embert csak egy tömeggel rendelkező objektummá alacsonyítja.

Továbbá a spártaiaknak és a gaz Newtonista tudósoknak meg jó dolog a a hegy tetejéről emereket ledobálni.

Le a gravitációval!

Peter T. Sinclare 2010.12.09. 16:54:05

@Gallis Deece: az idő a téridő kontinuum negyedik dimenziója. Bármely entitás, ami a téridőn kívül létezik, mentes a téridőn belül ismert időtől. Elemi logika.

Kérdés: ha a téridőn belül az idő mindenre hat, akkor a fizika törvényeire is hat? Ha nem, akkor a fizika törvényei a téridő kontinuumon kívüliek?

KenSentMe 2010.12.09. 16:54:13

@lacalaca: Még egy érv eszembe jutott, a hipotetikus omnipotens lényemmel kapcsolatban. Tegyük fel, hogy ez az omnipontens lény veszi az ÉT véletlen karaktersorozatát:

"LPEÁINTÚŐRÉZBEDBAYGASÁVZAZLAKLEÉ7VSNETÉLMTVTENOZFDEESEHKEÍ8AÖ
ERETGATEJFNTNAZGN"

nincs kedvem elvégezni a khí-négyzet próbát, de ha ezt a karaktersorozatot egy ember készítette úgy, hogy véletlenszerűen csapkodta a billentyűket, akkor egyszerű neurológiai okokból kisebb a véletlenszerűsége, mint egy igazi véletlen sorozatnak. (Az ember nem tud igazán véletlenszerű sorozatokat csinálni hasraütésre, még akkor sem, ha sok statisztikát tanult.)

És mi van, ha a mindentudó lényünk így okoskodik?

"Hohó, hiszen ez egy értelmes szöveg:

LP E ÁINTÚ ŐRÉZB E DBAY GASÁV ZAZLAKL E É7VSN E TÉLMTVT E NOZFDE E SEHK E Í8AÖ
E RETGAT E JFNTNAZGN

ez szinte olyan, mint a Smarwuf bolygó szuperintelligens lényeinek mesterséges nyelve. Egyértelműen erre utal, hogy az "E" náluk a névelő, és a névelők mentén jól szavakra tagolható a szöveg. Az mondjuk egy kicsit furcsa, hogy a szöveg kevés ismétlődő tövet tartalmaz, de ez a szöveg természetéből követkik - ez egy recept, amin rendkívüli összetevők különleges nevei vannak felsorolva. A recept teljesen tagolva így néz ki:

LP
E ÁINTÚ ŐRÉZB
E DBAY GASÁV ZAZLAKL
E É7VSN
E TÉLMTVT
E NOZFDE
E SEHK
E Í8AÖ
E RETGAT
E JFNTNAZGN

tartalmaz néhány elütést, például a SEHK helyesen SOHK volna, vagy az Í8AÖ létezését sosem sikerült bebizonyítani, de ennek ellenére ez nyilvánvalóan egy értelmes szöveg. Az is arra utal, hogy ez egy recept, hogy az LP a Smarwuf bolygó értelmes lényeinek a nyelvén az >Összetevők< szó rövidítése."

Gallis Deece 2010.12.09. 16:55:52

@Peter T. Sinclare: Tudja az összes lehetőséget, csomópontot, elágazást. Van valódi választás, mivel nem kényszerít választásra.

Azt ugye tudod, hogy ennek logikailag nincs semmi értelme?

Most tudja, hogy mit fogsz csinálni, vagy nem?
Ha nem tudja, nem mindentudó. Ha tudja, akkor már a világ keletkezésekor eldőlt, hogy mi fog történni, és akkor nincs szabad válsztás. És QED.
és LOL.

Peter T. Sinclare 2010.12.09. 16:56:44

@Gallis Deece: nem egészen :) ugyanis a newtoni, meg általában, a fizika törvényei nem mondanak semmit az ember, és az élet céljáról.

Az evolúció ezzel ellentétben mindkettőről beszél, és határozott állást foglal.

Dawkins egyike a vallásos evolucionistáknak, olyan dogmákkal, mint hogy az élet célja a gének továbbörökítése, vagy hogy a gének döntenek.

Ennek már komoly etikai hatása van.

Gallis Deece 2010.12.09. 17:01:46

@Peter T. Sinclare:
"Bármely entitás, ami a téridőn kívül létezik, mentes a téridőn belül ismert időtől. Elemi logika."

Nézd, ha valaki ott van az idő mindenhol az időben, a múltban, a jelenben, és a jövőben is, akkor az tud minden történést, ami "az időben" történik. Ergo Mindentudó. Ha mindentudó, akkor nincs választás.
Elemi logika...

lacalaca · http://cydonia.blog.hu 2010.12.09. 17:02:32

@Peter T. Sinclare: "1. egyszerűbbtől az összetettebbig (komplexitás tendenciája)
2. primitívebbtől az értelmesebbig
(intelligencia tendenciája)
3. egyedülállótól az ökoszisztémáig
(rendszer tendencia)
4. függőtől a függetlenig
(önfenntartás tendenciája)"

Persze, tudom, kivétel erősíti a szabályt, de az 1.-nek ellentmond, hogy a többsejtes élet szerencsés véletlen (khm), ami 3,5 milliárd évbe került (biztos kávészünet volt a tervezőirodán), és pl a mitokondrium-ős baktérium sejtbe költözése kellett hozzá. Amellett meg a biomassza jelentős része a mai napig baktérium.

A 2.-nek a dinoszauruszok fejlődése mond ellent, mert kitaláltak ők a repüléstől kezdve sokmindent, de értelmet nem nagyon. Ha nincs aszteroida, ki tudja, lett volna értelmes élet valaha (köszi, a krumplit tervező! Ja, a többit már összeszedhetnéd...)

A 3-hoz nem értek, a 4-re ott vannak a parazita fajok, szimbiotikus élőlények (van mélytengeri hal, ahol a hím szinte nem is él önálló életet), kölcsönös előnyökön élő, magasszintű fajok (madarak, akik az orrszarvúakat tisztogatják, stb).

(A tervezős kiszólások az ID-hívőknek szóltak.)

Peter T. Sinclare 2010.12.09. 17:04:03

@Gallis Deece: OMG. Figyelj, ha a mindentudó tudja, mi történHET, az nem jelenti azt, hogy tudja, mi fog történNI. Nem tudja, hogy te két, vagy három gombóc fagyit veszel-e, vagy veszel-e pisztáciásat, de tudja az összes lehetőséget.

Érted?

Vegyünk egy példát. Adott egy hagyományos dobókocka. Xyz eldobja. Te tudod az összes lehetőséget: 1,2,3,4,5, vagy 6-ot fog dobni, ugyanakkor hiperminimális valószínűsége van annak is, hogy megáll valamelyik oldalélén, sarkán, vagy megsemmisül.

Ismered az összes lehetőséget, de nem tudod, ténylegesen milyen eredmény fog kijönni.

Gallis Deece 2010.12.09. 17:05:15

@Peter T. Sinclare:
"fizika törvényei nem mondanak semmit az ember, és az élet céljáról."

Dawkins szavainak kiforgatása helyett nyissál már ki inkább egy biológia tankönyvet, és keresd már ki nekem azt a szakaszt, ami az ember és az élet céljáról szól.

"Ennek már komoly etikai hatása van."

A gravitációnak is.
Ha megfelelő magasságból lökünk le embereket, azok meg fognak szűnni élőnek lenni. Hatalmas etikai felelősség!

Gallis Deece 2010.12.09. 17:06:12

@Peter T. Sinclare:
"OMG. Figyelj, ha a mindentudó tudja, mi történHET, az nem jelenti azt, hogy tudja, mi fog történNI"

>Ergo nem mindentudó.

"Ismered az összes lehetőséget, de nem tudod, ténylegesen milyen eredmény fog kijönni."

>Ergo nem vagy mindentudó

fiziqs 2010.12.09. 17:09:08

@Peter T. Sinclare: A mindentudó tudja-e azt, hogy elhagy-e a barátnőm, ha megcsalom? Ha nem tudja, akkor mégsincs tisztában a tetteim következményeivel. Ha tudja, a barátnőm nem szabad.

Peter T. Sinclare 2010.12.09. 17:09:38

@Gallis Deece: már miért ne volna választás?! A te példádban a jövő már valami fix, lejátszott dolog.

Az én példámban pedig mindössze potenciálisan létezik.

lacalaca · http://cydonia.blog.hu 2010.12.09. 17:09:45

@VRbagoly: :) jó!

@Peter T. Sinclare: "Kérdés: ha a téridőn belül az idő mindenre hat, akkor a fizika törvényeire is hat? Ha nem, akkor a fizika törvényei a téridő kontinuumon kívüliek?"

Igen, lásd irreverzibilis folyamatok, második főtétel, eseményhorizontok, CP-szimmetriasértés, melyeknél mind számít az idő iránya.

fordulo_bogyo 2010.12.09. 17:27:18

@Peter T. Sinclare: "a természetes kiválasztással az a probléma, hogy nem ad választ sem az eltérő evolúciós sebességre,"

Miert kene arra valaszt adjon?

"sem arra, miként lehetséges, hogy az evolúció miért az értelmesebb fajoknak kedvez - egy dínófaj sokkal kisebb eséllyel él túl egy globális kataklizmát, mint egy baktérumfaj."

Ugy erted, a bakterium ertelmesebb? Vagy a dino ertemesebb, de kipusztul az evolucio soran?

"A következő tendenciák bizonyosan megfigyelhetők az evolúció során:
1. egyszerűbbtől az összetettebbig (komplexitás tendenciája)"

Ma is elnek bakteriumok. Csak arrol van szo, hogy az osszetettebb kialakulasahoz tobb lepes kell, tehat kesobb jelenik meg. De az egyszerubb is fennmarad, az evolucionak csak az egyk iranya az 1.

"2. primitívebbtől az értelmesebbig
(intelligencia tendenciája)"

Csak arrol van szo, hogy az ertelmesseg kialakulasahoz tobb lepes kell, tehat kesobb jelenik meg. De a kevesbe ertelmes is fennmarad, az evolucionak csak az egyk iranya az 2.
Ma is elnek bakteriumok.

"3. egyedülállótól az ökoszisztémáig
(rendszer tendencia)"

Nem ertek egyet.

4. függőtől a függetlenig
(önfenntartás tendenciája)

Hatarozottan nem ertek egyet. A novenyek lennenek az evolucio csucsa? Az emlosok testeben tobb bakteriumsejt van, mint emlosallat sejt. Meg hogy fuggetlen... mas elolenyek adjak az ennivalot amit eszunk, az oxigent amit belegzunk... meghogy fuggetlen...

Peter T. Sinclare 2010.12.09. 17:29:15

@lacalaca:
"Persze, tudom, kivétel erősíti a szabályt, de az 1.-nek ellentmond, hogy a többsejtes élet szerencsés véletlen (khm), ami 3,5 milliárd évbe került (biztos kávészünet volt a tervezőirodán), és pl a mitokondrium-ős baktérium sejtbe költözése kellett hozzá. Amellett meg a biomassza jelentős része a mai napig baktérium."

Miért mondana ellent? Az élet kialakulásához meg valami 12 milliárd év kellett nem? Ha a feltételek nem adottak A időszakban, B időszakban már létrejöhetnek. Vagy a szerves kémiának nincsenek törvényei, csak mert a szerves anyagok létrejöttéhez évmilliárdok kellettek?

Az, hogy a biomassza túlnyomó többsége egysejtű, sem pró sem kontra nem érv az 1. tendencia esetében.

A dínók nem "találtak ki" semmit, ugyebár. Másrészt az értelmükről sem beszélhetünk általánosságban, hiszen az emlősökre sem jellemző az értelmes beszéd, vagy a kultúraalkotás. Ezekre talán három emlősfaj volt képes, amiből egy él jelenleg. Harmadrészt több hüllőfaj is túlélte a kataklizmát. Negyedrészt a tendencia nem szűnt meg létezni: máskülönben az emlősök általában véve nem lennének intelligensebbek a hüllőknél.

A parazita fajok olyanok, mint a vírusok, és egy ötödik tendencia vonatkozik rájuk:
5. az élet az erőforrások lehető legjobb felhasználására törekszik
(erőforrás-optimalizációs tendencia)

A 4. tendenciát hiányosan írtam le, elnézést: a környezettől való függőség csökkenésének tendenciája. Ez összhangban áll a 3. tendenciával. Egy saját "erőművel" bíró élőlény függetlenebb a környezetétől, mint egy "erőmű" nélküli. Egy melegvérű faj függetlenebb egy hidegvérű fajnál. Egy kommunikációra képes faj függetlenebb egy kommunikációra nem képesnél. Egy együttműködésre képes csoport függetlenebb egy erre képtelen egyedekből álló csoportnál - ami csoport ha létre is jön, nagyon hamar meg is semmisül.

maycontainnuts 2010.12.09. 17:30:18

@(not_just_my)_one_and_only_rule:

A hittanórára tényleg beleillenének, csak mivel egyik valláshoz se köthetőek, elég fura hittanóra lenne.

"Gyerekek, valaki tervezte a dolgokat! És most, hogy ennyivel okosabbak vagytok, menjetek haza."

Hangsúlyozom, hogy az ÉRTEM a biológiaórát célozza.

Nézz rá erre és zokogj:
static.ertem.hu/downloads/0602_NAT.pdf

gyaloghartur 2010.12.09. 17:32:02

Először dobott Isten: lett RNS-világ.
Másodszor: archonok, trilobiták.
Harmadszor: halak, bogarak, békák.
Negyedszer:sárkány, sármány, cickány.
Ötödször:mamut, majom-ember.
Vajon dobni fog még egyszer?

Gallis Deece 2010.12.09. 17:34:05

@Peter T. Sinclare:

További OFFtopikot mellőzendő, teológiában és logikában jártas Peter T. Sinclare felvetésére a következő a végleges válaszom:

Az a Mindentudó, aki nem tudja a jövő heti lottószámokat, az nem mindentudó, mert nem tud mindent, rögtön: nem tudja a jövő heti lottószámokat.

Részemről a témát befejezettnek tekintem.

MosoMasa 2010.12.09. 17:38:47

@fordulo_bogyo: Ok.
És egyébként az intelligens tervezés be is fejeződött? Terveztek egyet oszt kész, ennyi? Mint isten?

Minek terveztek ennyi fajt, mivégre? Miért nem tökéletesek a fajok, ha ennyire intelligensek a tervezők? Miért van betegség, miért a gyilok? Az intelligens tervezők nem tudtak volna valami békés létet tervezni?

Ha nem fejezték be a munkát, akkor miért nem tökéletesítik a tévedéseket? Mert lenne mit....

etc., etc.,...

Gallis Deece 2010.12.09. 17:41:04

@MosoMasa:

Akárhányszor ilyeneket kérdezel, az Intelligens Tervező megöl egy macskát.

pucros 2010.12.09. 17:42:03

szerintem

Az Értelmes Tervezés szókapcsolatban az "Értelmes" valójában egy antropomorfizálás. Ha bele akarunk mászni, hogy mit értünk itt "értelmes" alatt, arra juthatunk, hogy aki az "Értelmes Tervezés" ideáját kitalálta, valószínűleg ezt nem végiggondolta, hanem magától értetődően megmintázta arról, amit mi emberek az "értelmünk" révén csinálni szoktunk. Hogy a világot valahogy úgy csinálták, mint amikor eltervezem, hogy ha akarok főzni egy lecsót, akkor kitalálom, hogy mit kell hozzá vennem a boltban stb.
Vagy nem így volt? Végig lett gondolva ennél valamennyivel egzaktabb módon?

Az értelem mibenléte egyáltalán nem evidencia. Szerintem, amennyire a "létező" emberi értelmet ismerjük, egyáltalán nem "típushelyes" akár csak nagy vonalakban is hasonlónak a működését feltételezni az Univerzum dolgainak irányítása mögött.

A hétköznapi életben viszont gyakran megfigyelhető egy általános "megszemélyesítési hajlam" nagyon sokaknál. Az nagyon is sajátja az emberi intelligenciának, hogy fogékony a mintákra, a rendezettségre, és felfedezi azt abban is, ami valójában random keletkezett. Általában a hétköznapi átlagember sokkal összevisszábbnak képzeli el a véletlent, mint amilyen az valójában. Az igazi véletlenre is rásüti, hogy "ezt direkt csinálták így", mert ezt a benyomást kelti benne. Ez az ősi érzület a forrása az összeesküvés-elméleteknek, és az "Értelmes Tervezés" koncepciójának is.

Pedig az emberi értelem nem olyan nagy dolog, hogy a természet ne hozhatott volna létre annak produktumaihoz mérhető dolgokat. És viszont: a Világegyetem létezésének a kontextusa nem olyan szerkezetű, nem olyan dimenziókban helyezkedik el, hogysem értelmezhető lenne az állítás, miszerint ott "értelem" tevékenykedik. Vagy ha igen, akkor az pőre homonímája annak az "értelemnek", amiről az emberrel kapcsolatban beszélhetünk.

Peter T. Sinclare 2010.12.09. 17:44:13

@VRbagoly: Mivel nem állok a tervezettség pártján, ezért a válaszom kissé másmilyen lesz, mint amire számít(h)a(t)sz:

A formafelismerés jó dolog, de önmagában nem elégséges az értelmesség felismeréséhez és valóban téves eredményre is vezethet.
Másrészt enélkül nem is ismerhetnéd fel a valóban értelmes információt.

Létezik:
1. értelmet nem tartalmazó, jelentéssel bírónak nem értelmezhető információ
2. értelmet nem tartalmazó, jelentéssel bírónak értelmezhető információ
3. értelmes, jelentéssel bírónak nem értelmezhető információ
4. értelmes, jelentéssel bírónak értelmezhető információ

magától értetődő, hogy a 3-as esettel nem sokat lehet kezdeni - ami nem megismerhető, azt nem lehet megismerni -, a 2-es pont az, amiről beszéltél, és kerülendő, az 1-es és 4-es esetek pedig azok, amelyekkel foglalkozni érdemes.

Az általad említett "scrabblesor" vizsgálatánál kiderül, hogy bár értelmes szakaszokból áll, összességében értelmetlen. Ha ilyennel találkozunk, akkor a forrás vizsgálatával azért kideríthető, hogy véletlenszerű, vagy értelmes, csak valami gikszer történt. Mondjuk egy gyenge hatásfokú fordítóprogram a ludas. lásd: dvd-játékos.

Ha véletlen folyamatok képesek véges időn belül értelmes elemekből álló és értelmes jelsort alkotni, akkor a fizikai törvények uralta világban komoly gondok vannak.

A kvantumfizika jó dolog, de éppen az ilyen "repkedő székek" esete mutatja azt, hogy csínján kell vele bánni. Ha repkedni kezd egy szék, akkor annak mindig is nagyon jó "hétköznapi" oka van.

Máskülönben folyamatosan random részecskéknek kéne mindenütt megjelenniük ;)

KenSentMe 2010.12.09. 17:45:13

@Peter T. Sinclare: Nagyon egyszerűen elmagyarázom, hogy az evolúciónak miért nincs etikai hatása.

Az erkölcsnek, a jó-rossz közötti választásnak ugyanis egyéni döntésnek kell lennie. Ha az ember nem választhat szabadon a jó és a rossz között, akkor nem is lehet erkölcsös vagy erkölcstelen (hiszen más irányítja a tetteit, nem ura önmagának).

Az etika mint tudomány azzal foglalkozik, hogy nekem, mint embernek, hogyan kell jól döntenem, mit jelent az igazságosság vagy a méltányosság, miért kell jól döntenem, mit jelent a jó döntés.. na most ezekről a biológia semmit sem mond. Az, hogy hogy alakult ki az élet, az semmit sem mond arról, hogy lelőjem-e a szomszédomat vagy lopjak-csaljak-hazudjak-e. Ezek az én döntéseim, mivel szabad, független lény vagyok. Ha magamtól úgy döntök, hogy ezeket nem csinálom, akkor erkölcsös vagyok, ha máshogy, akkor erkölcstelen. Ha azért döntök úgy, hogy ezeket nem csinálom, mert félek az isteni büntitől, akkor viszont nem vagyok erkölcsös, hiszen nem szabadon, nem a saját elhatározásomból döntöttem (hanem a félelmeim irányítottak).

Meg kéne már érteni végre, hogy az etikai kérdések, a morális kérdések mindig csak az egyént vizsgálva válnak értelmessé, tudományos tételek nem lehetnek sem erkölcsösek, sem erkölcstelenek.

Gallis Deece 2010.12.09. 17:46:09

@pucros: aki az "Értelmes Tervezés" ideáját kitalálta, valószínűleg ezt nem végiggondolta, hanem magától értetődően megmintázta blablabla.

Nem. Aki az Érteles Tervezést kigondolta, annak az járt az agyában, hogy hogyan lehetne bírósági döntéseket kikerülve, "Istent" "Értelmes Tervezőre" cserélve visszavinni a Bibliát a biológiaórákra.

Gallis Deece 2010.12.09. 17:48:01

@pucros:

http://hu.wikipedia.org/wiki/Értelmes_Tervezettség_Mozgalom#Az_intelligens_tervez.C3.A9s_t.C3.B6rt.C3.A9nete

Peter T. Sinclare 2010.12.09. 17:48:36

@Gallis Deece: nem forgatom ki Dawkins szavait, ő maga írja le, hogy mi a célja szerinte az életnek :)

Az, hogy az iskolai tankönyvek nem írják le a logikai következtetéseket, azok még nagyon is érvényesek. Ha az élet egyedüli célja a reprodukció, és az egyetlen saját és általánosan érvényes alaptörvénye - a fizika és kémia törvényein túl - a természetes kiválasztódás, akkor ott nincs sok mozgástér.

Persze, az evolucionisták is kitalálhatnak mindenfajta etikai szabályt, amit a saját világképükből vezetnek le, de az már vallás :)

egy csónakban 2010.12.09. 17:49:33

@Gallis Deece:

> Ugye nem kell elmondani, hogy az
> evolúció nem
> a "vak véletlen" elmélete?

Ugye nem kell elmondani, hogy ez Falus A. reagálása volt Dawkins-ra.
[ lásd . konkrét cikk ]

F.A:" Amikor Dawkins, Az önző gén című könyv szerzője azt mondja, hogy csak a vak véletlen uralkodik a világon, akkor átlép egy határt."

innen indult ki a téma ..

lacalaca · http://cydonia.blog.hu 2010.12.09. 17:51:45

@Peter T. Sinclare: "Az élet kialakulásához meg valami 12 milliárd év kellett nem?"
Nem, miután maga a Föld csak 4,5 milliárd éve jött létre, vagyis nagyjából ahogy adottak voltak a körülmények (pl nem borította lávatenger, etc), létrejött.

"hiszen az emlősökre sem jellemző az értelmes beszéd, vagy a kultúraalkotás. Ezekre talán három emlősfaj volt képes, amiből egy él jelenleg. Harmadrészt több hüllőfaj is túlélte a kataklizmát. Negyedrészt a tendencia nem szűnt meg létezni: máskülönben az emlősök általában véve nem lennének intelligensebbek a hüllőknél."

Most akkor értelmesebbek az emlősök, vagy sem? :) A kihalás elkerülésének meg nincs köze az értelemhez, sokkal inkább a testmérethez.

"Egy melegvérű faj függetlenebb egy hidegvérű fajnál."
mitől? Persze, éjjel is üzemel, de ára van. Egy melegvérű fajnak sokkal gyakrabban kell ennie (ha növényevő, praktikusan folyton), nincs el hetekig egy egérrel, mint mondjuk egy kígyó.

Megint inkább a rendelkezésre álló fülkék elfoglalása jön be, éjjeli üzemmód, stb. Ilyen tekintetben az 5. pont igaz: erőforrás-optimalizációs tendencia - persze mi számít erőforrásnak? Ha sokáig bírom éhen vagy ha folyamatosan mehetek, ha élelemben gazdag környezetben élek vagy ha szegényesebben, de ragadozóktól/konkurrenciától mentesen.

Egyébként amiken vitázunk, annak megint az evolúció az oka :) ugyanis itt már bejön, hogy folyon változik az élőlények rendszere, ahogy egymás mellett új fajok jelennek (halnak ki) meg más-más fejlődési ágakon, ahogy változnak az adott élettér feltételei. Amilyen a változás, olyan a stratégia. A hominidáknak bejött, hogy egyre nyeszlettebbekké váltak, illetve átálltak az erdőről a szavannára/két lábra, de cserébe nőtt az agytérfogatuk, felszabadult a kezük, stb, stb. A brontosaurusnak meg az jött be, hogy agya borsónyi maradt, de a teste meg több tonna, és nem kötött bele senki.

KenSentMe 2010.12.09. 17:54:00

@Peter T. Sinclare:

"Ha véletlen folyamatok képesek véges időn belül értelmes elemekből álló és értelmes jelsort alkotni, akkor a fizikai törvények uralta világban komoly gondok vannak."

Ez az, amiben szerintem nincs igazad. Ha most felrepülne a székem, abból nem következne, hogy folyton székek repkednének. Simán lehet, hogy se előtte, se utána soha nem történne meg (míg az univerzum létezik!), elmesélni se tudnám senkinek, mert senki se hinné el. A véletlenben az a szép, hogy ilyesmi bekövetkezhet - mert nincs, ami megtiltsa a véletlennek! Az kár, hogy bitang valószínűtlen és nagyon valószínűleg soha nem történne ilyesmi, de attól bármikor bekövetkezhet.

Gallis Deece 2010.12.09. 17:57:39

@egy csónakban:
FYI Falus erre a Dawkis-idézetre reagálhatott:

E pillanatban, hogy e mondatot papírra vetem, ezer és ezer állatot falnak fel elevenen; mások az életükért küzdenek, nyüszítve a félelemtől; megint másokat rágcsáló paraziták emésztenek fel lassan; ezren és ezren hullnak el éhínség, vízhiány és betegségek következtében. Ennek így is kell lennie. Ha egyszer valaha bőség köszöntene a világra, maga ez a tény addig növelné a populáció létszámát, amíg helyre nem állna az éhezés és szűkölködés természetes állapota.
. . .
ha a világmindenség csupán elektronok és önző gének halmaza volna, az ehhez a karambolhoz hasonló értelmetlen tragédiák nem jelentenének többet önmaguknál, s mi csupán az ugyanolyan értelmetlen jó szerencsében bízhatnánk. Az ilyen világmindenség se jó, se rossz szándékokat nem hordozna. Egyáltalán semmiféle szándékról nem árulkodna. A vak fizikai erők és genetikai replikáció világában egyesek megsérülnének, mások jobban járnának, és mi semmi ismétlődést, okot, igazságtételt nem olvasnánk az eseményekbe. A minket körülfogó világmindenség pontosan úgy viselkedik, amire akkor számíthatnánk, ha semmiféle tervszerűséget, célt, gonoszat és jót nem hordozna a mélyén, csupán vak, könyörtelen közömbösséget.

Eredetileg innen: www.goodreads.com/quotes/show/22201

lacalaca · http://cydonia.blog.hu 2010.12.09. 18:05:55

"Ha véletlen folyamatok képesek véges időn belül értelmes elemekből álló és értelmes jelsort alkotni, akkor a fizikai törvények uralta világban komoly gondok vannak."

Hogyhogy? Ez nem fizika, ez statisztika. Ha ismered a létrehozó mechanizmust, egyszerűen ki kell számolni, hány próbálkozásból lesz értelmes kombinációd (amit persze megint definiálni kéne először az adott folyamatoz). Ismered a rendelkezésre álló időt, a feladat elvégzéséhez szükséges idő, meg pl hogy párhuzamosan hány kísérlet zajlik (bizony). Dimenzióanalízis.

Különben meg ha genetikusnak DNS, akkor nekem ez egy értelmes jel, mivel van tudásom értelmezni:
www.au.dk/fileadmin/www.au.dk/pressen/Kepler/FIG4.jpg
És ennek a létrehozásához nem kellett tervező, puszta fizika kikeverte (bár kellett hozzá pármilliárd éve). Annyira hihetetlen lenne, hogy tudattalan gázgömbök képesek szabályosan (van szabály az "összevissza" görbében is!), óraműként változtatni a fényüket?

Peter T. Sinclare 2010.12.09. 18:06:15

@fordulo_bogyo: ""a természetes kiválasztással az a probléma, hogy nem ad választ sem az eltérő evolúciós sebességre,"

Miert kene arra valaszt adjon?"

Mert éppen, hogy ellentmond neki. A természetes kiválasztás értelmében az a faj, vagy ág, amelyik lassabban adaptálódik, az hamarabb hullik ki.

"Ugy erted, a bakterium ertelmesebb? Vagy a dino ertemesebb, de kipusztul az evolucio soran?"

Ok, látom, hol van a probléma - nem voltam elég egyértelmű. Tehát az evolúció során egyre értelmesebb fajok jönnek létre - bár vannak visszaesések, visszafejlődések is, de általánosságban érvényes -, mégis, a kataklizmák során mindig az egyszerűbb, elemibb fajoknak nagyobb a túlélési esélyük, vagy azoknak, amelyek gyorsabban adaptálódnak. Tehát hiába primitív élőlény egy skorpió egy lóhoz képest, egy atomháború esetén mégis a skorpiók fognak vígan továbbélni a sugárfertőzött területeken, míg a lovak nagyon nagy valószínűséggel kipusztulnak ott, ha nem a sugárzás miatt, akkor a nukleáris tél során.

Ha meg egy globális ultrakataklizma legyalulná a szárazföldeket, és felforralná a tengereket, a baktériumok, vírusok és valószínűleg a gombák még mindig túlélnék.

"Ma is elnek bakteriumok. Csak arrol van szo, hogy az osszetettebb kialakulasahoz tobb lepes kell, tehat kesobb jelenik meg. De az egyszerubb is fennmarad, az evolucionak csak az egyk iranya az 1."

Ez a tendencia nem szól arról, hogy a korábbi változatok kipusztulnak. Miért tennék?

"Csak arrol van szo, hogy az ertelmesseg kialakulasahoz tobb lepes kell, tehat kesobb jelenik meg. De a kevesbe ertelmes is fennmarad, az evolucionak csak az egyk iranya az 2.
Ma is elnek bakteriumok."

Ismét csak nincs szó ágkihalásról, másrészt miért KÉNE megjelenjen az értelmesség? Vagy szerinted van határozott iránya az evolúciónak?

"3. egyedülállótól az ökoszisztémáig
(rendszer tendencia)"

Nem ertek egyet."

Ettől még érvényes :D Az evolúció során mind összetettebb ökoszisztémák jöttek létre mind a szervezetek között, mind a szervezeteken belül. Az "önző gén" helyett az "együttműködő gén" diadalmaskodott.

"Hatarozottan nem ertek egyet. A novenyek lennenek az evolucio csucsa? Az emlosok testeben tobb bakteriumsejt van, mint emlosallat sejt. Meg hogy fuggetlen... mas elolenyek adjak az ennivalot amit eszunk, az oxigent amit belegzunk... meghogy fuggetlen... "

Vedd figyelembe a kiegészítést, amit tettem: a környezettől való függetlenségről van szó. Egyébként ezzel az ellenvetéseddel a 3-as tendencia érvényességét erősíted: az evolúció az együttműködő fajoknak kedvez és egyre összetettebb ökoszisztémákat hoz létre.

Gallis Deece 2010.12.09. 18:07:00

"nem forgatom ki Dawkins szavait, ő maga írja le"

Muti!

Amúgy meg Dawkis saját szavai:

www.youtube.com/watch?v=_jEzJiErYCQ

pounderstibbons 2010.12.09. 18:10:48

@pucros:

Megnemmondom, hogy hol olvastam, de valaki okos ember azt írta, hogy Ábrahám (ide behelyettesíthető tetszőleges vallásalapító) azt látta, hogy a körülötte lévő természetben van egyfajta rend (felülről jön az eső, alulról a giliszta, magból a búza, tél után a tavasz stb.). Ezt a rendet(tervezettséget?) bizonyára VALAMINEK a köszönhetjük.

Ezután csinált egy "ontológical dumping" nevű dolgot és az egész VALAMI-re azt mondta, hogy ezt az egészet VALAKI csinálta.

A tudomány egész jól halad a VALAMI felderítésével, de a VALAKI-ket csak nem lehet megtalálni. Mert már az elején feleslegesen rakták bele.

Az ID a kreacionizmusnál annyival jobb(?), hogy nyilvánvalóan bizonyíthatatlan kreós gyerekmeséket nem akar lenyomni senki torkán.
Csak így meg nincs is semmi a kezében.
Végül is az ID-sek tettek egy jó lépést a helyes irányba (mégha csak jogszabályi nyomásra is), már csak még egyet kellene tenniük és elvetni a VALAKI-t, és kész is volnánk, fel lehet számolni a Szkeptikus Társaság ID-vel foglalkozó részlegét.

Peter T. Sinclare 2010.12.09. 18:12:22

@fiziqs: a mindentudó tudja, milyen lehetőségei vannak a barátnődnek, de nem határozza meg, melyiket válassza.

Persze, ha a jövő lejátszott dolog, akkor a mindentudó pontosan tudja mit fog majd választani a barátnőd. De ha a jövő fix, akkor a jelenbeli döntések is mind bebetonozottak, tehát nincs választás.

Ha a jövő nem fix, akkor a mindentudó a lehetőségeket tudja. Nem tudja, mi fog pontosan történni, de! Mivel az nem létezik, így nem is lehet tudni.

Ha a mindentudás arra is vonatkozna, ami nem létezik, akkor a mindenbe beletartozik a semmi is, ami meg ontológiai képtelenség, mivel a semmi a létezés tagadása.

Peter T. Sinclare 2010.12.09. 18:15:51

@VRbagoly: A véletlennek két definíciója is létezik párhuzamosan:
1. adott esemény oka ismeretlen, és szubjektíven nem is sejthető
2. adott eseményt nem szándékosan idézték elő

Az első esetben a véletlen csupán egy Isten-helyettesítő szó, de semmivel sem kerültünk közelebb a valóság megismeréséhez, a második eset meg nem véletlen, mert az okság akkor is fennáll. A második eset szándékolatlanság, nem véletlen.

pounderstibbons 2010.12.09. 18:16:17

@Peter T. Sinclare:
A skorpió túlélésének záloga a lóval szemben katasztrófa esetén inkább a mérete.

Egy ló több kiló növényi rostot és sok liter vizet igényel naponta, ami egy nagyobb kataklizma esetén aligha állna rendelkezésére.

Viszont csak marad valahol egy skorpiópár némi nekik való kaja mellett, akik átvészelhetik a katasztrófát szimpla harmatcseppeken is.

A nagyméretű dinóknak is az egyik dolog ami betett az élelmiszerforrásaik hirtelen lecsökkenése, ami az akkoiban kb. patkányméretű emlősöket juttathatta előnyhöz.

Peter T. Sinclare 2010.12.09. 18:17:39

@lacalaca: és ezek közül melyik olyan fizikai törvény, amelyik értelmezhető idődimenzió nélkül?

Joaquin 2010.12.09. 18:31:18

@Peter T. Sinclare:A fizikai törvény egy általunk kitalált fogalom, csak és kizárólag a mi fejünkben létezik, így furcsa lenne, ha hatna rá az idő (persze az agyunkra hat...de ezt most ne keverjük ide szerintem).

Joaquin 2010.12.09. 18:33:13

Egyébként sem igazán értem mire vonatkozik a kérdésed... ez olyan "milyen szaga van az időnek" típusú kérdés...

Peter T. Sinclare 2010.12.09. 18:34:57

@lacalaca: ""Az élet kialakulásához meg valami 12 milliárd év kellett nem?"
Nem, miután maga a Föld csak 4,5 milliárd éve jött létre, vagyis nagyjából ahogy adottak voltak a körülmények (pl nem borította lávatenger, etc), létrejött."

Miért, a Föld létrejötte előtt minden körülmény adott volt az élet kialakulásához? Nem. A világegyetem feltételezett keletkezése és az élet földi kialakulása között - mivel csak ezt ismerjük - eltelt idő talán háromszorosa annak, mint az élet kialakulása és a mitokondrium feltételezett "beköltözése" közötti. Összevetve azonban sokkal nagyobb "tett" élettelen anyagból DNS-t csinálni, mint sejtmagot egy élőlénybe "tenni".

"Most akkor értelmesebbek az emlősök, vagy sem? :) A kihalás elkerülésének meg nincs köze az értelemhez, sokkal inkább a testmérethez."

Hát ez az :) egy komplett ágról általánosságban megfogalmazottak nem feltétlen érvényesek egy-két fajra.

A kihalást elég jól eséllyel el lehet kerülni, ha tudod, hogyan kerüld el... ez azonban meglehetősen későn jelent meg az evolúció során. Egy átlag főemlősfaj még bebukná, az ember azonban vélhetőleg jól venné az akadályt.

"Egy melegvérű faj függetlenebb egy hidegvérű fajnál."
mitől? Persze, éjjel is üzemel, de ára van. Egy melegvérű fajnak sokkal gyakrabban kell ennie (ha növényevő, praktikusan folyton), nincs el hetekig egy egérrel, mint mondjuk egy kígyó."

Például abban, hogy nincs napszakhoz kötve az aktivitása, tehát lehet, hogy gyakrabban kell ennie, de bármikor képes táplálékszerzésre, önvédelemre, vagy párzásra.

"Megint inkább a rendelkezésre álló fülkék elfoglalása jön be, éjjeli üzemmód, stb. Ilyen tekintetben az 5. pont igaz: erőforrás-optimalizációs tendencia - persze mi számít erőforrásnak? Ha sokáig bírom éhen vagy ha folyamatosan mehetek, ha élelemben gazdag környezetben élek vagy ha szegényesebben, de ragadozóktól/konkurrenciától mentesen."

Erőforrás bármi, amiből energiához jutsz :)

"Egyébként amiken vitázunk, annak megint az evolúció az oka :) ugyanis itt már bejön, hogy folyon változik az élőlények rendszere, ahogy egymás mellett új fajok jelennek (halnak ki) meg más-más fejlődési ágakon, ahogy változnak az adott élettér feltételei. Amilyen a változás, olyan a stratégia. A hominidáknak bejött, hogy egyre nyeszlettebbekké váltak, illetve átálltak az erdőről a szavannára/két lábra, de cserébe nőtt az agytérfogatuk, felszabadult a kezük, stb, stb. A brontosaurusnak meg az jött be, hogy agya borsónyi maradt, de a teste meg több tonna, és nem kötött bele senki. "

Az evolúció az egyik oka ;)
Attól ugyanis, hogy egy emlősfaj két lábra áll és kiköltözik a szavannára, még nem fog a végén internetet létrehozni, különben a prérikutyák már rég twitteren küldenék az infót a közelgő kígyókról :D

Az életmódváltás kevés. Az összes főemlősfajnak ugyanannyi, vagy több ideje volt arra, hogy végül (technikai) civilizációt hozzon létre. Mégsem tették a hominidákat leszámítva.

Peter T. Sinclare 2010.12.09. 18:36:13

@Joaquin: tisztában vagyok vele, és nem is kőtáblákra vésett lángoló aranybetűkkel írt törvényekről beszéltem én sem ;)

fiziqs 2010.12.09. 18:36:27

@Peter T. Sinclare: Azt én is tudom, milyen lehetőségei vannak a barátnőmnek. Ezekszerint sokkal nincs beljebb a mindentudó. De jól értem, hogy azt mondod, nem is lehet sokkal beljebb? Vagyis az a "minden" valójában nem is olyan sok.
A tudás egy mércéje, hogy milyen megbízható jóslatokat tud tenni az ember. (ld Popper a tudomány falszifikálhatóságáról)

Peter T. Sinclare 2010.12.09. 18:41:39

@pounderstibbons: hát nem csak :) a sugárzással szembeni tolerancia sokkal fontosabb. Az ember pl. jellemzően nagyobb és több élelemre van szüksége mint egy skorpiónak, és sokkal kevésbé tolerálja a sugárzást is, de szemben a többi fajjal képes sugárzásbiztos óvóhelyet, védőöltözetet és tiszta élelemforrást is előállítani.

Márpedig, elvileg, ez is evolúciós sajátosság.

Másrészt a dínókihalásos katasztrófa azért gyanús, mert elég sok nagytestű hüllőfaj túlélte, legalábbis az ősemlősökhöz képest jócskán nagyobb testű hüllők fajai is. Tehát nem érvényes általánosságban, hogy a kisebb test jobb túlélést biztosít. Inkább az optimális testméret biztosít jobb túlélést, az meg nem feltétlen a kisebb.

Joaquin 2010.12.09. 18:46:04

@Peter T. Sinclare: igen ezt sejtettem, hogy önigazolásra fogod használni, de őszintén szólva nem izgat. A tudomány e világbeli dolgokból vezet le e világi dolgokat. Ha te abban akarsz hinni, hogy ezen kívül van másik világ is, akkor hajrá.
Viszont azt ne álcázzuk tudományosnak, mint egyesek... Mókás ez a fajta hittérítés, mert az ő szempontjukból kontra produktív: az ember ugyanis sosem csak tételeket vesz át, hanem a hozzá tartozó axiómákat is. Jelen esetben egy ilyen axióma a tudományosság szempontjának megfelelni, onnantól azonban már csak intelligencia és tájékozottság kérdése, hogy bukjon az egész elmélet.

Peter T. Sinclare 2010.12.09. 18:47:07

@fiziqs: a mindentudó értelemszerűen azt tudhatja, ami valamilyen formában létezik. Ha a jövő képlékeny, mivel csak potenciálisan létező eredményekből áll, akkor kizárólag a potenciálisan létező eredmények tudhatók (mivel ami nem létezik potenciálisan sem, az semmilyen módon nem létezik, tehát ismerettel sem lehet róla rendelkezni).

Ha a jövő fix, akkor minden le van játszva, és akkor ugyan a mindentudó minden majd bekövetkező eseményről tud, de akkor meg nincs választás. Viszont az meg nem a mindentudó meglététől függ, mivel a jövő fix, tehát akkor is ugyanaz fog történni, ha valaki tud róla, mint ha nem tudna róla.

pounderstibbons 2010.12.09. 18:50:27

@Peter T. Sinclare:

Ki mondta hogy nukleáris kataztrófa éri a lovakat és skoriókat?

Mellesleg ha igaz amit írtál akkor már csak várnunk kell egy lóra aki óvóhelyet épít magána vagy találunk majd finoszauruszt ólomköpenyben...

Peter T. Sinclare 2010.12.09. 18:53:15

@Joaquin: Mit írtam a legelején? Hogy egy harmadik szempontot képviselek. Tehát nem térítek, és az sem zavar, ha nem fogadják el tudományosnak. Nekem megfelel, szívesen vitatkozom is róla, de hogy bárkit arra vegyek rá, hogy érvényesnek fogadja el? Köszi, nem :)

ha esetleg komplett tudományos világmodellt akarnék publikálni, akkor bizonyosan a tudományos axiómarendszerre alapoznék. De ilyen veszély nem fenyeget ;)

_Epikurosz_ 2010.12.09. 18:55:36

"ui: Amerikában most jelöltek az Energiaügyi Bizottság élére egy John Shimkust, aki szerint a klímaváltozástól azért nem kell félni, mert Noénak meg lett ígérve, hogy több globális katasztrófa nem lesz."
Tehát Isten politikus.

"Hangsúlyozom, hogy az ÉRTEM a biológiaórát célozza."
És Istent a politikusoknak akarják eladni.
Mint már oly sokszor, oly sok sikerrel, az összes többi ember kárára.

Peter T. Sinclare 2010.12.09. 18:56:22

@pounderstibbons: ez egy elképzelt helyzet, ami azonban a valóságban is megtörtént, több helyen a világon, még ha nem is feltétlen pont lovakkal és pont skorpiókkal. De Chernobil, vagy az összes atomrobbantások (amik az élővilág szempontjából mind katasztrófák) során éppen elég sok emlős és rovarfaj élte át a nukleáris katasztrófát.

_Epikurosz_ 2010.12.09. 18:57:24

@Peter T. Sinclare: Ha nincsenek (nagyon jó) axiómáid, nagyon gyorsan ellent fogsz mondani önmagadnak. Amiből egyenesen következik, hogy körbe fognak röhögni. Én szóltam.

Peter T. Sinclare 2010.12.09. 19:12:36

@Gallis Deece:
Néhány idézet tőle:
A darwini természetes kiválasztás „annak az információnak a nem véletlenszerű fennmaradása, amely ugyanennek a fennmaradásnak az embrionális receptjét kódolja. Magától értetődően elvárható, hogy a saját fennmaradását kódoló receptnek gondoskodnia kell a saját fennmaradásáról”
(425).

Értsd: Fennmarad, azért, hogy fennmaradjon, és folyamatosan alkalmazkodik a környezethez, úgy, hogy kiiktatja a fennmaradásban kevésbé sikeres programvariánsokat. Azért, hogy fennmaradjon.

Vagy:
"Minden gén arra törekszik, hogy másolatok formájában nagyszámú élőlényben legyen jelen a kortárs populációban és az egymást követő nemzedékekben"
(266)

Csakhogy a gén - még ha a teljes DNS-t is értjük alatta - nem törekszik semmire, mivel egy kódolt programsorozat. Tehát csak akkor terjed el, ha erre van kódolva. Ha meg erre van kódolva, akkor sem nem önző, sem nem törekvő, még átvitt értelemben sem.

Az meg, hogy az élet alaptörvénye az anentrópia, éppen nem az önzést -ami entropikus törekvés -, hanem az együttműködést támogatja.

Végül:
„Feleslegesség? Milyen nonszensz! Szentimentális emberi nonszensz. Maga a természetes kiválasztás is teljesen felesleges. Minden az önsokszorozásra vonatkozó önsokszorozó utasítások fennmaradásáról szól”
(410)

Idézetek forrása:
Richard Dawkins: A legnagyobb mutatvány, 2009

Peter T. Sinclare 2010.12.09. 19:17:39

@_Epikurosz_: vannak axiómáim, de itt nem az én világképem a beszélgetés tárgya, hanem az evolúció meg az ID. Persze az axiómákkal önmagukban gond van: mivel bizonyításra nem szoruló alaptételek, minél több van belőlük, annál dogmatikusabb a rendszer. A végén meg igazi nyugati vallássá válik:

"az evolúció megkerülhetetlen tény… hogy meggyőzik-e a bizonyítékok az ésszerűen kételkedőket? Ésszerű kételkedés? Minden idők kedvenc mellébeszélése" (31)

Pedig az evolúció egy tudományos elmélet, egy modell. Mindaddig az, amíg lehet benne kételkedni. Ha el KELL fogadni, onnantól nem elmélet, hanem vallás.

gitáros 2010.12.09. 19:30:05

@pounderstibbons:
Én is kösz, ez kurva jó... :))
Önégető hülye.

Peter T. Sinclare 2010.12.09. 19:33:14

@VRbagoly: "Nagyon egyszerűen elmagyarázom, hogy az evolúciónak miért nincs etikai hatása...
Meg kéne már érteni végre, hogy az etikai kérdések, a morális kérdések mindig csak az egyént vizsgálva válnak értelmessé, tudományos tételek nem lehetnek sem erkölcsösek, sem erkölcstelenek. "

Akkor én meg elmondom, mi ezzel a probléma.

Az erkölcs, avagy etika mindig szilárd alapokkal kell rendelkezzen. Az ököljog erre nem megfelelő: bármikor jöhet egy erősebb, aki azt mondja, mostantól változik az erkölcs - elég sok példa van erre a történelemben.

Ha a szokásjog az alap, ugyanez a helyzet: jön valaki, más szokásokkal és megváltoztatja az etikai szabályokat, csak mert megteheti.

Marad a filozófia/világnézet és a természet.

A filozófia/világnézet azonban min nyugszik? A teista változatok egy, a természet felett álló intelligencián, az ateista verziók pedig a természeten.

Ha a természetet - ami alatt értelemszerűen az élővilágot és annak saját törvényeit értjük - úgy tekintjük, mint egy globális arénát, ahol az egyedüli cél a túlélés, akkor abból nehéz humanista filozófiát levezetni, mivel egységes emberiség nincs. A humanizmus jó dolog, de amikor a nyers túlélés a cél, akkor egyszeriben odavész a humánum. "ember embernek farkasa"

Ezért a hagyományos evolucionista természetfelfogásból közösségi, de antihumanista etika ered.

Rorschach · http://lowfast.blog.hu 2010.12.09. 19:40:30

@pounderstibbons:

Hahaha :D

És már megint milyen türelmesen magyaráznak neki... A helyükben már rég elküldtem volna melegebb éghajlatra azt a trollt, már csak azért is, mert amellett hogy kőhülye, még egy mocskolódó büdös gyökér, más blogokon is mindig beugat mindenkinek...
Egy nagy verés hiányzik neked wmikikém, titokban szerintem arra vágysz...

Tom Benko 2010.12.09. 19:40:32

@wmiki: Még mindig várom a kérdéseimre a válaszaidat, az állításaidra a bizonyítékaidat... Képes vagy erre egyáltalán? (Már ha olvasod is, amit írok.)

_Epikurosz_ 2010.12.09. 19:40:54

@Peter T. Sinclare: A kételkedés mindig ésszerű, és előreviszi a tudományt, csak a dolgok nagyon pontos megvizsgálása is kell hozzá. Ha csak a levegőbe kételkedsz bele, az olyan, mintha nem is mondtál volna semmit.
A tudományos elméleteknek szért vannak axiómáik, mert azokra logikai alapon lehet építeni, és így következtetéseket lehet levonni. Ha a valóság egyezik a következtetésekkel, akkor a tudományos elmélet egész jó. Ha nem, akkor vacak.
Ha nincsenek olyan axiómáid sem, mint amilyen "A létező van", akkor nincs miből kiindulni. Ha az axióma fogalmát összekevered a tetszőleges állítás fogalmával, az nem az én bajom.

Joaquin 2010.12.09. 19:47:09

@Peter T. Sinclare: "úgy tekintjük, mint egy globális arénát, ahol az egyedüli cél a túlélés, akkor abból nehéz humanista filozófiát levezetni"

"I have gained this by philosophy: that I do without being commanded what others do only from fear of the law."
Aristotle
en.wikiquote.org/wiki/Aristotle

akdiana (törölt) 2010.12.09. 19:49:19

Számomra az ilyen vitákban az szokott a meglepő lenni, ha valaki netán azzal nincs teljesen tisztában mi ellen, avagy mi mellett érvel. Meglepően sokan nem tudják, hogy az evolúció és az evolúció elmélete nem egy és ugyanaz. Az evolúció tény, az evolúció elmélet meg még finomítható, nem feltétlen tökéletes.

Akit érdekel, ajánlom dr. Kampis György előadását (Mindentudás Egyetem):
www.mindentudas.hu/kampisgyorgy/20060509kampis1.html?pIdx=1

Joaquin 2010.12.09. 19:52:13

@Peter T. Sinclare: amúgy ezzel a social evolution foglalkozik (neem, nem Marx és Engels). Természetesen levezethető.

_Epikurosz_ 2010.12.09. 19:53:13

Végül egy idézet: A tény egy egyszerű állítás, amiben mindenki hisz. Ártatlan, amíg bűnösnek nem találtatik. A feltevés egy újszerű javaslat, amiben senki sem akar hinni. Bűnös, amíg igaznak nem találtatik. - Teller Ede

Igen, ez tényleg így működik, és attól, hogy amatőrök vagytok, a tudósok még nem fogják könnyebben megadni magukat, mint tudóstársaiknak.
Jó éjt, mára befejeztem a zrikálást.

peti papagáj 2010.12.09. 20:23:02

pompás kezdeményezés ez az egész, de a vita végén majd jelentkezzen, akinek bármiben is megváltozott a szemlélete

lacalaca · http://cydonia.blog.hu 2010.12.09. 20:40:52

@Tom Benko: nyugi, wmiki nem válaszol kérdésekre, vagy csak így (/wmiki algoritmus on):

a szent és tévedhetetlen tudomány nem válaszol neked, hívő?

azt hittem a tudomány tévedhetetlen

persze elvakult hívőkkel hiába vitatkozok

/wmiki algoritmus off.
Erre van beprogramozva. Idejön, böffent egyet, aztán megy is a tenyérjósához. Pláne ha a saját világnézetét próbálod belőle kihúzni, szerintem az még nincs benne az adatbázisban.

TH 2010.12.09. 20:52:18

@individuum: annak ellenére, hogy semmi komoly kétségem nincs az evolúcióelmélettel szemben, teljesen egyetértek veled, egy magukat szkeptikusnak nevező szekta egy tagja lenézően megnyilatkozott egy másik szekta tagjairól. a poszt kb. ilyen, szerencse, hogy a vita maga színvonalasabb.

fiziqs 2010.12.09. 20:55:57

@Peter T. Sinclare: Köszi, kezdem látni a "mindentudó" képességeinek korlátait. Arra felelj még, a mindentudó be tud valahogyan avatkozni a világ folyásába? A kezdeti feltételeket állította be (ha igen, hogyan), vagy folyamatosan bele-beleszól (hogyan)? Honnan tudjuk mi azt, hogy ő mindentudó?

MetálFater (törölt) 2010.12.09. 21:01:04

Idézet a fenti vitaindító iratból.

"Az Értem kötéltáncosai egyetlen kérdést tettek fel, amelyik nem tekinthető költőinek, vagy nem válaszolták meg saját maguk:

"Lehetséges-e, hogy a fajok mai jellegzetességei a leszármazás folyamata során, korábbi fajok apró átalakulásai révén jöttek létre? Bár vitapartnerünk szerint „sok-sok példát” lehet erre mutatni, érdekes módon egyet sem említ közülük."

Veterán harcosunk azonnal előránt egy félig retek, félig káposzta élőlényt, amelynek keletkezésekor több elfogadott fajfogalom szerint is vitathatatlanul két fajból egy elkülönült, harmadik faj jött létre, és csiklandozni kezdi vele a sarokba szorultak orrát."

Véleményem.

Nekem a fenti állításokhoz lenne egy gondolatom.

A tudomány mai állása szerint több alkalommal is volt ún. "nagy kihalási hullám."

Az egyik (az utolsó) a Pangea feldarabolása során történt.
Akkor a meglévő fajok 98%- kipusztult.
( Könyörgöm! Most mellőzzük a 64 millió évvel ezelőtt történt "meteor által történt dinoszaurusz kihalásokat. Ekkor ugyanis már több emlős faj is élt.)
Ebben az időszakban alakult ki az emlősök mai őse a Morganucodon.

Nos.

"Lehetséges-e, hogy a fajok mai jellegzetességei a leszármazás folyamata során, korábbi fajok apró átalakulásai révén jöttek létre? ... „sok-sok példát” lehet erre mutatni, érdekes módon egyet sem említ közülük."

Ez megfelelő válasz lehet.
Ugyanis ha a fenti tudományos álláspont igaz, akkor ebből következik a dedukció, miszerint
a maradék 2%-ból ered a mai fajok eredete.
És ezen felül, pedig EGYETLEN fajból az emlősök eredete.

Fikázás helyett, észérveket várok...

Mystes 2010.12.09. 21:06:41

Gyerekek! Számomra ez a szkeptikus blog ugyanolyan egyoldalúnak tűnik, mint akiket kritizáltok, nevezetesen a hívők, vagy 'rosszul' hívők. Az, hogy Isten teremtette a világot (vagy ugyanennek a tagadása), az egy ontológiai kijelentés. Nincs és nem is lehet rá 'bizonyíték'. Akkor miről beszélünk?

DR.version · http://m-12.blog.hu 2010.12.09. 21:08:18

ki az aki elfogadja az evoluciot, ugy hogy kozben istenben is hisz
jahogy az emberek 99%-a? akkor ilyen tudatlan kozegben nem mindegy mi az igazsag?

ghavin 2010.12.09. 21:12:24

@Peter T. Sinclare: "Az erkölcs, avagy etika mindig szilárd alapokkal kell rendelkezzen."

Na de hát a teista morál alapja egy vagy több önkényesen kijelölt transzcendentália. Attól, hogy beböksz egy félig-meddig közös nevezőt a számtalan egykor volt és most is létező "teista morálfilozófiához", azzal újfent nem mondtál semmit erről a feltétlenül szükséges szilárd alapról. Én hajlok arra, hogy ilyesmi objektíve nem is igen létezik, ergo soha nem is volt szükség rá, bár én az etikát már önmagában is a pejoratív értelemben vett szofizmus non plus ultrájának tartom. Igaz, ami igaz, mindig készen állok arra, hogy meggyőzzenek az ellenkezőjéről. :)

"Az ököljog erre nem megfelelő: bármikor jöhet egy erősebb, aki azt mondja, mostantól változik az erkölcs - elég sok példa van erre a történelemben."

A túlélés záloga minden esetben a vetélytársak eltiprása? Ez rendkívül demagóg leegyszerűsítés.

"Ha a szokásjog az alap, ugyanez a helyzet: jön valaki, más szokásokkal és megváltoztatja az etikai szabályokat, csak mert megteheti.

Marad a filozófia/világnézet és a természet."

Már ne is haragudj, de ha a filozófiát, világnézetet megfosztod a kulturális tradíciótól, akkor nem marad belőlük semmi.

"A filozófia/világnézet azonban min nyugszik? A teista változatok egy, a természet felett álló intelligencián, az ateista verziók pedig a természeten."

És ha a transzcendentáliák megléte természetes szükségszerűség, s nem önálló létezők?

"Ha a természetet - ami alatt értelemszerűen az élővilágot és annak saját törvényeit értjük - úgy tekintjük, mint egy globális arénát, ahol az egyedüli cél a túlélés, akkor abból nehéz humanista filozófiát levezetni, mivel egységes emberiség nincs. A humanizmus jó dolog, de amikor a nyers túlélés a cél, akkor egyszeriben odavész a humánum. "ember embernek farkasa"

Ismét leegyszerűsíted a dolgot, s újfent demagóg vagy.

"Ezért a hagyományos evolucionista természetfelfogásból közösségi, de antihumanista etika ered."

Miért erőltetnénk rá a természetre a humanizmust, amikor a természet kurva jól meg van ember nélkül is? Elég naiv ember lehetsz, ha így a XXI. század elején még mindig ott tartasz, hogy az ember lenne a világegyetem közepe...

ghavin 2010.12.09. 21:14:18

@Mystes: Hogy szabad-e tudományt csinálni egy "ontologikus" pszeudotudományból (ID).

Mystes 2010.12.09. 21:21:05

@Ghavin: Nem! Nem szabad. Az ID valószínűleg 'öntudatlan' (válasz)reakció az olyan hülyeségekre, amik meg a 'szkeptikusok' sajátja. Mert a szkeptikusok meg azt nem tudják pl megérteni, hogy Isten teremtői mivolta a feltámadásból is maradéktalanul megérthető. Márpedig az történeti...

KenSentMe 2010.12.09. 21:22:22

@Peter T. Sinclare:

"Az erkölcs, avagy etika mindig szilárd alapokkal kell rendelkezzen. Az ököljog erre nem megfelelő: bármikor jöhet egy erősebb, aki azt mondja, mostantól változik az erkölcs - elég sok példa van erre a történelemben."

Öhm. legyünk történetileg pontosabbak, bár alapvetően ezt a megjegyzést köszönöm, mert sok minden eszembe jut róla. Történetileg három különböző szintű etika létezik.. a deontológiai etikák, az utilitarista etikák és az erényetikák. Gondolom, az "ököljog" alatt az utilitarista etikákat érted, és igazából az fáj neked, hogy az evolúció aláássa az erényetikákat, a megalapozottságukat, mintegy tönkretéve azokat a nagy eszmerendszereket, amik az embereket erényesebbé teszik.

Mondjuk én már eleve megkérdőjelezném, hogy az ismert nagy etikák, például Arisztotelész, Spinóza, Kant etikája, vagy éppen a jó öreg Heller Ágnes etikája erényesebbé teszi-e vajon az embereket, mivel ezeket sem ismerni, se olvasni nem szokták (ezért (is) gondolom úgy, hogy ez az emberek személyes döntése.. az, hogy egy átlagos politikus lop-e, annak általában köze sincs hozzá, hogy Heller Ágnes milyen filozófiai megalapozást készít az erényetikáihoz).. komolyan, egy átlagos ember homályosan, legfeljebb ennyit tud ezekről:

"A filozófia/világnézet azonban min nyugszik? A teista változatok egy, a természet felett álló intelligencián, az ateista verziók pedig a természeten."
Öh, öh, öh, köh, köh. Arisztotelész annak idején egy komplett erényetikát készített, anélkül, hogy fogalma lett volna róla, pontosan min is nyugszik az (!). Becsületesen leírja a Nikomakhoszi etika elején, hogy ő tudja rendszerezni az erényeket, meg tisztában van vele, hogy csak az élhet boldogan, aki erényes, de nem tudja, hogy ez miért van így, miért nyeri el a rossz méltó büntetését.. tisztában van vele, hogy ennek az okai számára kibogozhatatlanok, és eleve csak olyanoknak ajánlja a könyve olvasgatását, akik hisznek abban, hogy érdemes erényesen élni. Miért van az, hogy csak az lehet boldog, aki dolgozik, tanul, nem öl embert, nem lop, stb.? Miért van az, hogy aki nem dolgozik, nem tanul, embert öl, lop, az nem lehet boldog? Arisztotelész nem tudta, de úgy vette észre, hogy ez valamiért így van.

Arisztotelész óta a legfontosabb etikai feladat kitalálni, hogy miért van ez így.. hogy miért kell az erényesség a boldog élethez.. szilárd filozófiai megalapozást készíteni az etikához.

Ha ki is hirdetnék, hogy holnaptól mindenki ölje meg a szomszédját, mert evolúció van és egy maradhat, az nem magyarázná meg, hogy az a világ miért volna élhetetlen egy átlagos ember számára. Hogy miért van az, hogy valamiért mégis kell az erkölcs. Miért van az, hogy az ember szenved egy olyan világban, amiben nincsenek vagy rosszak az erkölcsök? Ez az, amit kutat az etika.

És ez a tévedésed: hogy sosem a tudomány mondja meg a világnak, hogy működjön, hanem mindig a világ alakítja a tudományt azáltal, hogy egyre jobban próbáljuk megérteni azt.

"Ha a természetet - ami alatt értelemszerűen az élővilágot és annak saját törvényeit értjük - úgy tekintjük, mint egy globális arénát, ahol az egyedüli cél a túlélés, akkor abból nehéz humanista filozófiát levezetni, mivel egységes emberiség nincs. A humanizmus jó dolog, de amikor a nyers túlélés a cél, akkor egyszeriben odavész a humánum. "ember embernek farkasa" Ezért a hagyományos evolucionista természetfelfogásból közösségi, de antihumanista etika ered."

Duplán nem értelek. Egyfelől az evolúcionista megközelítés hasznos, mert sok mindent meg lehet érteni belőle (hogy pl. miért van az, hogy a süllyedő hajónál először a nőket ültetik a mentőcsónakba). De miért következne ebből szükségszerűen antihumanista etika? Nem értem, hogy hiheted, hogy két mondatban levezettél mindent, ami etikailag levezethető, mikor ezzel könyvespolcokat írtak tele.

Amikor a nyers túlélés a cél, akkor néha az ember megáll, és rájön, hogy vannak fontosabb dolgok is, mint a személyes túlélése. Ebből keletkezik a hősiesség és az önfeláldozás. És miért akadályozná az evolúcióelmélet a hősiességet és az önfeláldozást? Nem szünteti meg. Ha én úgy döntök, hogy feláldozom az energiáim, a pénzem, a szabadságom, vagy akár az életemet egy cél érdekében, akkor nincs az a Darwin, aki engem ebben korlátoz, hiába evolucionista a felfogásom. (Mert hidd el, nekem aztán evolucionista a felfogásom.) Amellett, hogy tisztában vagyok az evolúció működésével, hihetek abban, hogy emberként léteznek fontosabb dolgok is a személyes túlélésnél. Hogy az, hogy a világ szebb és élhetőbb legyen, esetenként fontosabb lehet az én jövőmnél.

Ez az a pont, ahol igazán tévedsz: csak félművelt ember vezet le gazemberségeket az evolúcióból.

ghavin 2010.12.09. 21:24:24

@Mystes: "Márpedig az történeti..."

Most trollkodsz? Remélem... Egy meséskönyv nem igazán képezheti alapját egy tudományos vitának.

Mystes 2010.12.09. 21:33:25

@Ghavin: Szia. Nem trollkodok. A feltámadásból nyugodtan kiindulhatnak a szkeptikusok is. Nem kell Ádámtól, Évától kezdeni, hiszen a történeti megértésben a szkeptikusok, úgy látom, még nem jutottak el odáig, mint a hívők többsége, nevezetesen, hogy az evolúciót és az istenhitet nem látják egymással szembenálló dolgoknak, mivel megértették, hogy pl a Teremtés könyvében foglaltakat nem kell szó szerinti történelemírásnak felfogni, a szó mai értelmében.

Goompah 2010.12.09. 21:39:41

@Gallis Deece:

Ó jaj, én szívesen hozzászólok wmikihwz, mert élvezem olvasni a sületlenségeit, ahogy a bohócot is élvezem a cirkuszban. Azt pedig még inkább, hogy annyi beégés után még mindig nem veszi észre magát.

@pounderstibbons:

Ajjaj, wmiki már időtlen idők óta teszi ezt a kijelentést:

"Azt már megállapították itt a fórumon, hogy a tudomány sosem téved.
És nyilván mindent tud a világról."

Holott ezerszer megmondták neki, hogy éppen a tudomány nem állít ilyet soha. Na de wmiki épp ettől olyan szórakoztató.

ghavin 2010.12.09. 21:39:49

@Mystes: "A feltámadásból nyugodtan kiindulhatnak a szkeptikusok is."

Engedtessék meg, hogy a szkeptikusok nevében beszéljek: egy ókori mítosz (feltámadás) nem tartozik azok közé a khm... jelenségek közé, amik bármiféle "megértés" alapját képezhetnék számukra. Ennek oka baromi egyszerű: a mítosz nem tény, kivéve ha az ember feltétlenül hisz az ilyesmiben vagy egy olyan vallás híve, aminek részét képezi az adott mítosz.

Mystes 2010.12.09. 21:50:42

@Ghavin: Nem tudtam, hogy Jézus feltámadása mítosz, és nem történelem. De érdekelnének az érveid, hogy miért nem az. (Már ha ezek szerint korunk a történelemben hisz...)

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 21:52:04

@Goompah: hogy érted, hogy a tudomány nem tud mindent a világról???

tudsz olyat mondani, amit nem tud? no ugyehogy nem?
és olyat, amikor tévedett?? naugye

vagyis a tudomány nem téved és nyilván érthető, ha ezek az itteni hősök (akiket itt egyes kommentelők szektásoknak neveznek) felveszik a harcot a babona és a más eszmék ellene, és kigúnyolják azokat, akik másban merészelnek hinni, mint amit a szent tudomány állít!!

halleluja tévedhetetlen tudomány, harca elvtársak!!

Goompah 2010.12.09. 21:57:26

@wmiki:

"hogy érted, hogy a tudomány nem tud mindent a világról???"

Szerinted ezt hányféleképpen lehet érteni?

"tudsz olyat mondani, amit nem tud? no ugyehogy nem?
és olyat, amikor tévedett?? naugye"

Te állítottad, hogy a tudomány (a művelői szerint) mindent tud a világról és tévedhetetlen. Kérlek, bizonyítsd ezt az állításodat. Ne kommentek alapján, hanem valamely komolyabb természettudós szavaival.

inebhedj - szerintem 2010.12.09. 22:01:40

Pardon, hogy beleszólok a Mindentudó + szabad akarat kontra evolúció vitába, de az én szemszögemből feltűnt, hogy komolyan összekeveredtek az inerciarendszerek, ti.:

Ha a Mindentudó egyidejűleg jelen van minden időpillanatban, és minden lehetőségben, akkor látja minden döntésre adható összes válasz összes következményét - ez a jövőre vonatkozó rész. De ugyanígy látja a múltra vonatkozó részt is, azaz minden döntés okát, sőt a döntéshelyzetek okait is. Ebből pedig az következik, hogy a Mindentudó természetesen tudja azt is, hogy mikor milyen döntést hozunk, miért, és mi lesz a következménye. Mindezek felett be is tud avatkozni - ha úgy gondolja, hogy be akar avatkozni (ez azonban már sejtet egyfajta mikrokozmosz a makrokozmoszban helyzetet).

Csorbítja-e ez a szabad akaratot? Valójában nem. Az ember ugyanis javarészt nincs a fentiekkel tisztában, még a döntéshelyzet vagy a döntés okait sem ismeri feltétlenül, az alternatívák következményei végképp talányosak számára. A szabad akarat ugyanis csak akkor csorbul, ha a csorbulással az áldozat tisztában van. (Vö.: Az ateista az, aki azt hiszi, hogy nem hisz.) A hit és a bizonyosság egymással szemben álló, de egymást kiegészítő tényező (akárcsak a logikus és az empirikus gondolkodás). A hit a késztető, a mozgásban tartó, a változó, míg a bizonyosság a megnyugvó, állandósuló, mozdíthatatlan. (Gyakorta összekeverik a kettőt, a hitet az egyházzal, a tudományt a vallással.)

Itt van például a Wikileaks ügye, amelynél _hihetünk_ abban, hogy ez az igazságos, nyílt világhoz az interneten keresztül vezető út, ugyanakkor _tudhatjuk_, hogy egy meglehetősen visszataszító manipuláció, amely az igazságtalan, zárt világhoz vezető internetet hozza el. Hihetjük, hogy a Wikileaks ügy a szabad akaratért folytatott harc, és tudhatjuk, hogy a totális ellenőrzés és befolyásolás fegyvere.

A Mindentudó mindentudását megítélni vagy mérlegre tenni az ő - közvetett - teremtménye nem tudja, és mivel a teremtmény nem mindentudó (csak hasonlatos), így szabad akarata van.

KenSentMe 2010.12.09. 22:02:06

@Goompah: Hahahaha, elhamarkodott kijelentés volt;) Hahahahahahahaha.

"akiket itt egyes kommentelők szektásoknak neveznek"

Az SZT-t valójában csak egyes kommentelők nevezik szektásoknak, bár ezek a személyek leginkább általános iskolában fizikából voltak egyesek.

ghavin 2010.12.09. 22:02:48

@Mystes: "Nem tudtam, hogy Jézus feltámadása mítosz, és nem történelem."

Tudom, hívőként nehéz lehet az ilyesmit feldolgozni, de a történelemtudomány nem tekint úgy Jézusra, mint egykor valóban élő történelmi személyre, akinek pályafutását a rá vonatkozó bibliai passzusok történelmi hitelességgel festették volna le. Persze te még hihetsz benne, hogy Jézus élt, varázsolt egy kicsit, meghalt, aztán feltámadt, csak vedd tudomásul, hogy ez csupán a te egyéni meggyőződésed, s nem tény avagy történelem.

Mystes 2010.12.09. 22:19:15

@Ghavin: Akkor hogyan tekint a 'történelemtudomány' Jézusra? Amúgy: mi a történelemtudományi kritérium valaki történelmi létezésére?

ghavin 2010.12.09. 22:26:13

@Mystes: Röviden? Jézus a keresztény vallás (egyik) központi alakja. Úgy, ahogyan Zeusz az ókori görög vallás egyik központi alakja volt, vagy mondjuk ahogyan Ámon Ré az egyiptomié. A történelemtudomány ezt tudomásul veszi, de nem kezeli történelmi tényként, hogy Zeusz szórja a villámokat, Amon koronaként viselné a napkorongot vagy hogy Jézus anno borrá varázsolta volna a vizet a kánai menyegzőn.

Mystes 2010.12.09. 22:31:17

@Ghavin: Megpróbálom újra feltenni a kérdést: a mai történettudomány szerint mi a kritériuma valaki történelmi létezésének?

ghavin 2010.12.09. 22:42:14

@Mystes: "a mai történettudomány szerint mi a kritériuma valaki történelmi létezésének?"

Őszintén szólva lövésem sincs. A történelemtudomány sok mindent effektív létezőnek kezel: magukat az írásos forrásokat (nem feltétlenül a bennük megfogalmazódó állításokat), régészeti leleteket, egyéb tudományterületek (például nyelvészet) kutatási eredményeit, satöbbi. Ezen bizonyítékok alapján sok mindenre lehet következtetni, többek között egy vallás történetére. Mondanom sem kell, hogy a vallás önigazolásaként összeállított Újszövetség(ek, ugyebár több verzió létezik) igencsak kétes "bizonyítéknak" számít annak eldöntésére, hogy valóban történt-e keresztény értelemben vett feltámadás avagy sem.

KenSentMe 2010.12.09. 22:45:49

@Mystes: (Erre csak egy történész tudna válaszolni. Laikusként: nyilván erős bizonyítékok kellenek. A kortársak leírása, egy holttest, a sírhelye, mondák, mítoszok.. Jézust szerintem azért lehet vitatni, mert a halála után csak sok évvel írtak róla, nincsenek meg a csontjai, a Biblián kívül életéről keveset tudni, nem készültek róla életében szobrok.. stb.

Számomra egyébként szimpatikus, ha valaki a tudományba vetett bizalmat össze tudja egyeztetni a vallásos hittel, és szerintem lehetséges az ilyesmi.)

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 22:53:16

@VRbagoly: kár, hogy ez utóbbi csak feltételezés, amire semmi bizonyítékod nincs :(((

nem csoda, ha szektásnak neveznek...
persze nem én, én tudom, hogy a tudomány sosem téved, és ki kell irtani, aki kételkedni merészel a szent tanokban

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 22:54:15

@Goompah: bizonyítsd be te, hogy van amit nem tud, és van amikor téved???

ugyehogy nem tudod
vagyis a tudomány mindent tud

Tom Benko 2010.12.09. 23:01:04

@wmiki: Bocs, a pozitív állítást kell bizonyítani.
De csak a kötözködés kedvéért: Nem ismert mondjuk a glükózmolekula kvantummechanikai leírása=>a tudomány nem tud mindent.
Most légy szíves bizonyítsd az állításod, te szektás!

Tom Benko 2010.12.09. 23:04:25

@lacalaca: Ne izgulj, tudom. Olyan ez, mint az állatkertben etetni a majmokat: megfelelően kínálva kifejezetten szórakoztató, még ha mindig ugyanazt is csinálja. :)

Tom Benko 2010.12.09. 23:05:55

@wmiki: Hupsz, kértél tudományos tévedést is, mesze, egy: éterelmélet...

Tom Benko 2010.12.09. 23:08:28

@Mystes: Ha nincs és nem is lehet rá bizonyíték, akkor értelmetlen a tudományba keverni.

inebhedj - szerintem 2010.12.09. 23:11:19

A történelemtudomány (laikusként) egyébként nem fizika, mint VRBagoly hozzászólása is jelzi, hiszen, mivel Krisztus feltételezett működése idejében mindössze néhány ezer emberről készültek feljegyzések, kortárs leírások, szobrok, a sok milliós Róma és Egyiptom léte sem feltétlenül alátámasztható a történelemtudomány számára elfogadható módon.

A történelemtudomány politikai érdekek, illetve hipotézisek logikai vagy empirikus szövedéke, számos ellentmondással, kompromisszummal és vitával. Például a néhány tízezer fős gót törzseknek "királyuk" van, míg minden idők legnagyobb kiterjedésű birodalmát csak egy "fejedelem" vezetgeti a történelemtudomány szerint. De írhattam volna az időszámítás elkezdése (nem a kezdete!) előtti fél ezer év (tehát az isz. V-X. század) európai történelmét is, amelynek kutatását és feltárását rendkívül megnehezíti a X-XIII. század visszamenőleges okirat-hamisítási szokása. Még az olyan, nem túl távoli időben történt, és meglehetősen grandíózus történelmi események, mint a 30-40-es évek zsidóellenes német politikájának gyakorlata is komoly vitákat vált ki (most felejtsük el azt, hogy a törvény rendeli el a holocaust megtörténtét, ezáltal az tudományos és történelmi kérdésből egyházi dogmává válik), mégpedig nem is feltétlenül a nácik és a partizánok, hanem történészek és kutatók között, mivel a források és hivatkozások nem alakulnak közmegegyezés folytán ténnyé a felek számára (ehhez szükség van pár száz évre).

Semmi sem változik olyan gyorsan, mint a megváltoztathatlan múlt - hogy frázist puffantsak a végére. :)

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 23:12:16

@Tom Benko: de tudja, tedd fel a szkeptikus fórumon, és megmondják mi, csak esetleg túl ostoba vagy, hogy megérts ilyen fennkölt tanokat

Mystes 2010.12.09. 23:14:25

@Ghavin: Ha keresztény-ellenesek állítanák a feltámadást, akkor jobban hihetnénk benne?

ghavin 2010.12.09. 23:17:51

@Mystes: Tessék? Nem értem a kérdést.

1) Milyen keresztény-ellenesek? Kik?
2) Milyen feltámadást állítanának?
3) Milyen jellegű hitre gondolsz?

Mystes 2010.12.09. 23:19:12

@VRbagoly: A 'csontok' ebben az esetben éppen hogy nem bizonyítanák a feltámadást. De, ugye mondhatjuk, hogy a feltámadáshit akkoriban sokakat zavart? Márpedig, ha zavart, akkor miért nem jöttek elő, épp a kortárs zsidók, azzal, hogy Jézus 'csak mítosz'?

pszeudozsiráf 2010.12.09. 23:20:13

@Peter T. Sinclare:

"Marad a filozófia/világnézet és a természet.

A filozófia/világnézet azonban min nyugszik? A teista változatok egy, a természet felett álló intelligencián, az ateista verziók pedig a természeten."

Némi kreativítással el lehet képzelni harmadik verziót is. Nem alapszik semmin. Az is egy lehetőség, hogy nincsenek végső, abszolút etikai törvények, ezeket csak az ember találja ki, és rengeteg háborút vívtak meg miatta. Ezért a helyes döntés kiválasztásánál valamilyen totálisan más szemléletre van szükség. Nem etikán alapulóra. Nem ideológián alapulóra.

Mystes 2010.12.09. 23:20:42

@Tom Benko: A teológia valóban nem abban az értelemben tudomány, mint ahogy mondjuk a természettudomány.

pszeudozsiráf 2010.12.09. 23:21:23

@Peter T Sinlare:

Másrészt megfelelő érv -e az evolució egyes elemeinek elvetésére az, hogy nem tetszenek a következményei?

KenSentMe 2010.12.09. 23:21:27

@wmiki: Bizonyítsd be, hogy semmi bizonyítékom nincs!

Mystes 2010.12.09. 23:23:29

@Ghavin: Jól gondolkodsz, amikor azt mondod, hogy azok a források gyanúsak, amiket valamely ügy képviselői maguk hoznak létre (Evangéliumok). Ezért kérdeztem, hogy amennyiben ezen hit ellenzőitől lennének bizonyítékaink, akkor azt jobban elfogadnád-e?

Goompah 2010.12.09. 23:27:50

@wmiki:

"bizonyítsd be te, hogy van amit nem tud, és van amikor téved???"

Te állítottál valamit, te bizonyítsd. :) Amúgy meg Tom Benko megírta a frankót.

Válaszolj egyetlen kérdésre: manapság létezik természettudomány? És ha igen, miért létezik, ha már mindent tud a tudomány? Minek kutat ma is, ha már mindent tud?

pszeudozsiráf 2010.12.09. 23:28:50

@Peter T. Sinclare:

Harmadrészt pedig az evolucióból egyáltalán nem következik hogy ember embernek farkasa kell legyen. Sőt. Azt látjuk, hogy legtöbbször evoluciós szempontból kifizetődőbb stratégia kisebb közösségeket ápolni. Ez az állatoknál sincs másként. Ezért az önző gén csak egyetlen modell. Ugyanilyen alapegység lehet a populáció is és ez is jó modell lehet a szelekcióra. Azt hiszem erről végeztek szimulációkat és az erőforrások mennyisége egy jelentős faktor ebben. Minél több az erőforrás annál inkább a gén szelekció érvényes, minél kevesebb, annál nagyobb a valószínűsége, hogy kisebb-nagyobb közösségek alakuljanak ki és a túlélési verseny a közösségek között folytatódjon.

Goompah 2010.12.09. 23:29:08

@Mystes: No igen, maradjunk csak a természettudományoknál és a matematikánál.

ghavin 2010.12.09. 23:29:39

@Mystes: Nem, ugyanis az evangéliumok íróinak nem-keresztény kortársai is általában véve ugyanolyan babonásak voltak, mint maguk az evangélisták. A 16. század előtt élt kartográfusok sem rajonghattak túlzottan a tengeri szörnyekért, mégis ilyen alakokkal díszítették a térképeket, mert elterjedt tévhit volt, hogy óriási tengeri lények felelősek a hajókat sújtó viharokért.

Goompah 2010.12.09. 23:33:57

@Mystes: "Az, hogy Isten teremtette a világot (vagy ugyanennek a tagadása), az egy ontológiai kijelentés. Nincs és nem is lehet rá 'bizonyíték'. Akkor miről beszélünk?"

A tudomány nem is foglalkozik ezzel a kérdéssel, nem próbálja sem bizonyítani, sem cáfolni.

Amikor valaki hevesen szembeállítja a teremtést és az evolúciót, mindig azt szoktam kérdezni, vajon Istent mi akadályozhatta meg abban, hogy a teremtés eszközéül az evolúciót válassza.

KenSentMe 2010.12.09. 23:35:47

@Mystes: Nem vagyok elég felkészült történelmileg, hogy erre válaszoljak, szörnyű ezt leírni, de így van. A kereszténység kialakulásának történetéről például keveset tudok.. meg hogy akkoriban kiket zavartak az őskeresztények, kik vitatták a nézeteiket, egyáltalán, mennyire voltak jelentősek ahhoz, hogy bárkit is érdekeljenek, hogyan erősödött meg az egyház.. ki gondolta, hogy mítosz, ki gondolta, hogy nem az.. vagy hogy milyen emlékei maradtak meg a feltámadásnak.. csak okoskodni tudnék, azt pedig nem szeretnék.

Mystes 2010.12.09. 23:36:47

@Goompah: Miért szűkítenénk le gondolkodásunk körét önként, amikor erre semmi nem kényszerít? Hát nem a szabadságról szól ez az egész izé, szkeptikus blog?

Mystes 2010.12.09. 23:42:01

@Ghavin: Viszont azért a krisztushit eléggé zavarhatott bizonyos zsidó (és nem zsidó) köröket ahhoz, hogy simán a hívők képébe vágják, hogy: ugyan miről beszéltek ti, hiszen Jézus 'egy mítosz"! Mégsem tették. Vajon miért? Sőt, nemhogy nem tették, hanem ők maguk állítják indirekte, hogy Jézus történelmi személy azzal, hogy mondják: Jézus holttestét ellopták (a hívők). Egy mítosz holttestét nem lehet ellopni...

ghavin 2010.12.09. 23:43:01

@Mystes: "Hát nem a szabadságról szól ez az egész izé, szkeptikus blog?"

Nem.

"tudományos szkepticizmus – tudományos vagy gyakorlati állásfoglalás, amelyben valaki az olyan állítások valóságosságát kérdőjelezi meg, amelyek nincsenek a tudományos módszer szerint igazolva."

Mystes 2010.12.09. 23:46:17

@Goompah: Teljesen igazad van. Ontológiai kijelentések nem tartoznak a természettudomány körébe.

Veder1 2010.12.09. 23:46:30

@Mystes, bár nem vagyok történész, de ha jól tudom a jelenlegi történettudomány fő sodra Jézust elismeri, mint létező személyt, prófétát, vallásalapítót (pl, Josephus Flavius alapján). De mivel nem sokat lehet rekonstruálni az életéből a halála után jóval később keletkezett vallásos szövegeken kívül, így leginkább ezen szövegek történelemre való hatását vizsgálja. A történeti Jézussal meg annyira foglalkozik, mint pl. Homérosz állítólagos létezésével.

wmiki · http://kigondoltam.blog.hu/2014/07/20/stephen_hawking_538 2010.12.09. 23:48:56

@Goompah: remélem nem arra célzol újra, hogy van amit a tudomány nem tud a világról!!!

akkor egyesekben felmerülhetne, hogy a sok nemtudáson alapuló elméleteket miért kell bemagolni állami intézményekben

meg mikor válik végre szét az állam, és a hittérítés???

Mystes 2010.12.09. 23:51:12

@Ghavin: Akkor bocsánat. Ha itt nem azért gondolkodunk, hogy szabadabbak legyünk.

Peter T. Sinclare 2010.12.09. 23:51:38

@_Epikurosz_: Dawkins esetében az axióma dogmává lett.

Máskülönben egyetértek veled. A lényeg változatlan: addig tudományos egy elmélet, amíg lehet benne kételkedni és törekedni a cáfolására.
Onnantól, hogy egy elméletről kijelenti valaki, hogy az tény, nincs helye kételkedésnek, máris vallást teremtett.

Peter T. Sinclare 2010.12.09. 23:52:32

@equalizer: szerintem sem az. Az okot az okozat miatt elvetni strucc-viselkedés.

maycontainnuts 2010.12.09. 23:53:57

@Mystes:
"Számomra ez a szkeptikus blog ugyanolyan egyoldalúnak tűnik, mint akiket kritizáltok, nevezetesen a hívők, vagy 'rosszul' hívők. Az, hogy Isten teremtette a világot (vagy ugyanennek a tagadása), az egy ontológiai kijelentés. Nincs és nem is lehet rá 'bizonyíték'. Akkor miről beszélünk?"

Hogy kerülnek ide a kommentjeidbe a hívők, meg Jézus, a feltámadása és a többiek?
A vita MINDKÉT résztvevője kijelentette többször is, hogy semmilyen egyházhoz, vagy valláshoz nincs köze, ahogy azok tagadásához se, Az evolúcióelméletnek pont ugyanúgy nem eleme se a keresztény Isten, se Jézus, mint ahogy az ID-nek sem.
Akkor miről beszélünk?

Mystes 2010.12.09. 23:53:59

@Vödör: Ez nem igaz. A teológia nagyon is sokat foglalkozik Jézus személyével, és azzal, hogy abból mit lehet történetiként elfogadni. Az általában vett történelemtudománynak persze nem kiemelt tárgya a Jézus Krisztussal való foglalkozás.

Veder1 2010.12.09. 23:54:32

@Mystes mit jelent a szabadság, milyen kötelékektől akarsz szabadulni?

Peter T. Sinclare 2010.12.09. 23:54:45

@equalizer: nem az a kérdés, mit tudunk kitalálni :) ott a határ a csillagos ég. Viszont az etikának is megvannak a maga axiómái. Például az, hogy minden szabálynak szüksége van eredőre.
Az ugyanis nem válasz, hogy "csak mert".

Peter T. Sinclare 2010.12.09. 23:57:40

@equalizer: pedig ez következik belőle, és empirikus úton ezerszer is bebizonyosodott már. A történelem számtalan példát szolgáltat rá.

Az ember azonban képes önként meghaladni az ösztöneit, ezáltal létrehozhatott olyan természet- és evolúcióellenes eszméket, mint amilyen a humanizmus.

Veder1 2010.12.09. 23:57:52

@Mystes én nem teológiáról beszéltem. A teológiával én nem tudok mit kezdeni, szerintem a vallásokat lehet nem vallásos alapról kiindulva is vizsgálni.

pszeudozsiráf 2010.12.09. 23:58:55

@Peter T. Sinclare:

Ezt nem értem, kifejtenéd kicsit :)

Buzzword 2010.12.10. 00:00:23

@wmiki: A tudomány nem tud mindent, ezt bármelyik tisztességes tudós beismeri.

Saját példa: A diplomamunkám egy kínai tudós korábbi tanulmányát is felhasználta a digitális aláírás pénzügyi felhasználásának témakörében (informatika/matematika). A kínai tanulmány sok új ténnyel bővítette az emberiség tudásanyagát, de volt benne egy tévedés. Ezt a tévedést megtaláltam, bebizonyítottam és kijavítottam. A hiba megtalálása nem sikerült volna a tudományos oktatás nélkül, amiben részem volt.

(Azt viszont elmondhatnád végre, mit tanítsanak az állami egyetemen, ha nem tudományos tételeket és elméleteket).

pszeudozsiráf 2010.12.10. 00:03:00

@Peter T. Sinclare:

Ugyanennyi ellenpéldát is szolgáltatott rá a történelem: összetartásról, hűségről, szülő -gyermek szeretetről, stb.
Csak ezt nem írják le a történelemkönyvekben mert csak a háborúknak volt világméretű hatása. Határokat szétszabdaltak, új rendszerek, új ideológiák jöttek létre. És valóban mindezt azért hogy megtagadjuk, amik valójában vagyunk: emberek. Önzők és kicsinyesek néha pedig szeretetre képesek.

Mystes 2010.12.10. 00:06:04

@Vödör: A szabadság lehet (intellektuális) cél. A szkeptikusság nem. Az csak eszköz.

ghavin 2010.12.10. 00:08:13

@Mystes: Most a számtalan, egymásnak, s legfőképp az evangéliumoknak ellentmondó keresztényellenes forrásra hivatkozva próbálod nekem bebizonyítani, hogy Krisztus feltámadása minden kétséget kizáróan történelmi tény? Nem akarlak megbántani, de ez enyhén szólva szánalmas. Különben sem Jézus alakjáról, hanem erről az egy konkrét eseményről beszélünk.

Öntsünk tiszta vizet a pohárba: a történelemtudomány bizonyítékként kezel minden forrást, ám a cél sohasem a bennük esetenként megfogalmazódó állítások igazságtartalmának eldöntése, különösen, ha olyan ellentmondásokban tobzódó koncepcióról van szó, mint a keresztény feltámadás.

pszeudozsiráf 2010.12.10. 00:08:37

@Peter T. Sinclare:

Ilyen szempontból az evolució, és egyáltalán saját természetünk megértése, sokkal értelmesebbnek tűnik, mint különböző ideológiákat, erkölcsi rendszereket alkotni, hogy elfedjük és elmeneküljünk a valóság elől, ami az orrunk előtt van: Mindenkit a saját boldogulása érdekel a legjobban. Csak a valóság látása után vagyunk képesek valódi cselekvésre.

Peter T. Sinclare 2010.12.10. 00:09:08

@Ghavin: Ez így nem igaz. Jézus létére éppen olyan bizonyítékok vannak jelenleg, mint a csillagászatban az első exobolygók felfedezése idején, vagy mint a fekete lyukakra: közvetett hatásokból egyértelmű, hogy kell ott legyen valami.

Jézusnak rengeteg követője volt, akikről vannak kortárs feljegyzések, rengeteg híve hivatkozik rá a saját feljegyzéseikben, és ahogy a történelemtudomány egyre jobban megismeri a korakereszténységet, az egyház történetét, stb., úgy válik az is világossá, hogyan lett a magát Megváltónak, de nem istennek tekintő reformer rabbiból Isten feltámadott Fia, aki elvette a világ bűneit. Hogyan alakult ki a reformer zsidó közösségben a szembenállás a péteri és páli irányzat között, ami az utóbbi győzelmével végződött, stb.

Egy történelmi személy nélkül mindez nem létezhetett volna.

Mystes 2010.12.10. 00:10:11

@maycontainnuts: Igazad van, elvittem a beszélgetést más irányba! Akkor visszatérek a témára: az evolúció nem zárja ki a teremtést. Mivel a teremtés ontológiai jellegű valami, az evolúció meg egy természettudományos tan. Először biológiai, aztán más tudományokat is megtermékenyített, ma már nélkülözhetetlen a megértéshez. Ehhez képest az ID nem más, mint egy pszeudo tudomány/teremtéstan. Egyik sem, mivel/pedig mind a kettő akar lenni.

Peter T. Sinclare 2010.12.10. 00:13:02

@equalizer: megpróbálom :)
ha nem tudod megindokolni, miért kell valamit megtenni, akkor mivel is győzöl meg másokat, hogy megtegyék?

Éppen ezért kell minden etikai irányzatnak szilárd alap, mert különben az irányzat megsemmisül.

A teista etikai rendszereknél az istenség olyan abszolút hatalmi forrás, amelynél szilárdabb nem létezik. Az, hogy az adott istenség létezik-e ténylegesen: mellékes. Axióma, hogy létezik.

Mystes 2010.12.10. 00:13:23

@Vödör: Természetes! Sőt, ajánlatos is :)

Mystes 2010.12.10. 00:15:10

@Ghavin: Én nem mentem ilyen messze, hogy a feltámadást akarnám bizonyítani. Csak odáig mentem, hogy Jézus történelmi személy.

Peter T. Sinclare 2010.12.10. 00:15:24

@Mystes: nem csak kizárja, de meg is kérdőjelezi. Ha volt teremtés, miért kellett kicsiben kezdeni, miért nem minden fajt odarakott a Teremtő, ahova? Ha meg kicsiben kezdte, akkor azóta nem is nyúlt bele, hagyta menjen minden a maga útján? Ez illogikus.

Veder1 2010.12.10. 00:15:37

@Peter T. Sinclare én inkább a jakabi és a Páli irányzat konfliktusát írnám.

pszeudozsiráf 2010.12.10. 00:17:03

@Peter T. Sinclare:
:)
Akkor ezzel kapcsolatban a kérdéseim:
-Egyáltalán miért KELL valamit megtenni?

- Miért KELL meggyőzni másokat hogy tegyenek meg valamit?

- Tehát megsemmisül. Miért van szükség irányzatokra?

- Miért következne az istenség abszolut autoritásából bármilyen abszolut etika?

Veder1 2010.12.10. 00:19:00

@Peter T. Sinclare erre mondaná azt egy hívő, hogy "Isten útjai kifürkészhetetlenek" ;-)

Persze ekkor már a tudományon kívüli területre léptünk.

Mystes 2010.12.10. 00:19:42

@Ghavin: Miért is tobzódik ellentmondásokban a (keresztyén) feltámadás?

Peter T. Sinclare 2010.12.10. 00:20:46

@equalizer: Természetes, hogy erős szociális érzékkel és érzelmi képességgel bír az emberi faj, és az értékrend, világnézet felül tudja írni az ösztönöket, azonban ezek kis lokális csoportokon, hordaszinten működik.

Példák, ellenpéldák: mindenre vannak a történelemben. Azonban az erőszak többnyire sikeresen oldotta meg a vitás kérdéseket.

Veder1 2010.12.10. 00:20:55

Lovecraft horror-író mítoszrendszerében az istenek vakok és idióták. Ez is egy lehetőség :)

Mystes 2010.12.10. 00:23:46

@Peter T. Sinclare: Hogy a Teremtés miért olyan, amilyen: nem tudjuk. Olyannyira nem, hogy még annak a fogalomnak a használata is, hogy "Teremtés" - egy ontológiai kijelentés, ha akarod, hitkijelentés. Jobb azonban egyelőre nincs :)

pszeudozsiráf 2010.12.10. 00:23:56

@Peter T. Sinclare:

"Természetes, hogy erős szociális érzékkel és érzelmi képességgel bír az emberi faj, és az értékrend, világnézet felül tudja írni az ösztönöket, azonban ezek kis lokális csoportokon, hordaszinten működik. "
.. ergo a világnézet és értékrend nem képes felülírni az ösztnöket. Hosszútávon biztos nem. elnyomni esetleg.

Peter T. Sinclare 2010.12.10. 00:25:09

@equalizer: azért KELL, mert máskülönben nem működnek a dolgok. Az individualizmus jó dolog, de a valódi erő a közösségben rejlik. Krízishelyzetben meg nem lehet demokráciásdit játszani.

A meggyőzés célja az, hogy ne kérdőjelezzék meg folyton, miért KELL valamit megtenni. ;)

Az irányzatok szükségszerűen létrejönnek. Evolúciós, pszichológiai, stb. okai vannak, hogy létrejöhetnek.

Ha a fundamentum abszolút, és az abszolútum a saját akaratát nyilvánítja ki, hozzátéve, hogy ez az örök és változatlan akarata, akkor ebből - a rendszer saját logikája alapján - következik, hogy az etikai rendszer is abszolút lesz.

Peter T. Sinclare 2010.12.10. 00:25:49

@equalizer: egyedfüggő. Ez benne az izgalmas. A többségnél nem képes, másoknál meg igen.

Peter T. Sinclare 2010.12.10. 00:28:34

@Vödör: eredetileg Péter és Pál közötti vita volt: Pétert támogatta a többi apostol, Pál meg bizonygatta a saját igazát; majd miután mindketten meghaltak, már a jakabi ősegyház és a páli gyülekezetek közötti vita volt; végül a többség győzött. Igaz, ha nincs Pál, akkor kereszténység sincs ma.

Peter T. Sinclare 2010.12.10. 00:31:18

@Joaquin: Arisztotelész humanista volt?

Veder1 2010.12.10. 00:31:56

@Peter T. Sinclare valóban. Csak a nagyobb hatású konfliktus maradt meg bennem.

Peter T. Sinclare 2010.12.10. 00:33:08

@fiziqs: Ácsi, mindentudóról beszéltünk. A beavatkozás más terület.

A mindentudó korlátai attól függnek, hogy milyen az idő természete. Elvárható, hogy a mindentudó tudjon arról is, ami semmi? Beszélgessünk már a semmi létezőiről, légyszi :)

ghavin 2010.12.10. 00:33:49

@Peter T. Sinclare: "Ez így nem igaz. Jézus létére éppen olyan bizonyítékok vannak jelenleg, mint a csillagászatban az első exobolygók felfedezése idején, vagy mint a fekete lyukakra: közvetett hatásokból egyértelmű, hogy kell ott legyen valami."

Ez így baromság. 1) egyenlőségjelet teszel az optika és történelemkutatás közé, ami nettó dilettantizmus 2) figyelmen kívül hagyod, hogy egy koncepció olykor függetleníthető a koncepció hatásától, ami bruttó csőlátás. Kár, amúgy egész csinos költői kép lett volna.

"...Egy történelmi személy nélkül mindez nem létezhetett volna."

1) Pedig simán, elég megnézni, hogy a vitatott korban a számos messiás mellett hány olyan kultusz létezett, ahol nem isteneket, hanem isteni manifesztációkat imádtak. A történelmi alak (a valóban élő személy) nem esett egybe a manifesztálódó istennel, hanem a kettő egyesülése képezte az imádat tárgyát (Ízisz, Mithrasz-kultusz, satöbbi) 2) Ennek alapján ha létezett is a történelmi Jézus, elég valószínűtlen, hogy kvázi "egybeesett" volna a bibliában ábrázolt varázsló-figurával.

pszeudozsiráf 2010.12.10. 00:35:06

@Peter T. Sinclare:

Miért, így működnek a dolgok?
Rengeteg erkölcsi , és etikai rendszer, ideológia és vallás létezik, mindegyik a maga abszolut istenével és kinyilatkoztatásaival, hogy korrektek legyünk soroljuk bele most a tudományt is. Ha körülnézel a világban, úgy látod, működnek így a dolgok? Úgy látod ez a sok rendszer és világnézet változtatott bármit is az ember alaptermészetén, természetes viselkedésén? Akkor ezt én is szeretném látni :)

Az hogy nem kell megtenni valamit, abból nem következik az individualizmus.
A közösségben valódi erő rejlik valóban. De mit számít ez az erő, ha bár ideológia tartja össze, ugyanakkor az ember alaptermészete ugyanaz? Akkor ez az erő csak nagy pusztítást képes okozni.

Létrejönnek irányzatok, de én azt kérdeztem: szükségesek -e az általad mondott erényes élethez?

De ha nem tudjuk hogy a fundamentum létezik-e, akkor honnan tudhatnánk hogy kinyilvánítja -e az akaratát. Minden kulturában más fundamentum van, más kinyilatkoztatásokkal. Akkor most melyik az abszolut?

Az etikát az ember találja ki és próbálja ráerőltetni valami soha nem múló entitásra, hogy biztonságban érezze magát. És ebből aztán szép nagy zűrzavar keletkezik...

Mystes 2010.12.10. 00:39:36

@Ghavin: Arra a kérdésre, hogy Jézus történelmi személy-e, igennel vagy nemmel lehet/kell válaszolni. Ha ez megtörtént, akkor lehet továbbgondolkodni.

ghavin 2010.12.10. 00:42:37

@Mystes: A puszta feltámadás koncepciójának abszurditásán túl a passió kezdete és a mennybemenetel között eltelő eseménysor leírásai számos ponton ellentmondanak egymásnak az evangéliumokban, annak ellenére, hogy az egyház éppen ezt elkerülendő, számos alkalommal átszerkesztette és esetenként átírta a szentírást, ami úgy látszik annyira mégsem szent.

Veder1 2010.12.10. 00:45:33

@Ghavin a szentlélek vezette a kezüket...

ghavin 2010.12.10. 00:46:45

@Mystes: Akhilleusz történelmi személy-e? Alakjának van története, sőt mi több, történelme is, s a kultúrára, tehát az emberekre gyakorolt hatása tagadhatatlan. Alakját számos mitikus elem övezi. Ha történelmi személyként kezelem, akkor ezek a mitikus elemek minden kétséget kizáróan valósnak tekintendőek-e vagy sem? Neked meg ezen kéne előbb elgondolkodni, mielőtt továbbgondolkodsz.

KenSentMe 2010.12.10. 00:47:36

@Peter T. Sinclare: Ez a vicc, hogy ilyen a teista etikai rendszerek mégsem erősek annyira. Lásd pl. a jezsuitáknál az eretnekek elégetése. Ők hittek abban, hogy tényleg az Isten akarata, hogy el kell égetni azokat az embereket - ezáltal mérhetetlen szenvedést okozva nekik. Mivel egy ilyen deontológiai rendszerben az Istennel bármi megindokolható (bármilyen jócselekedet vagy szörnyűség), ezért nem képeznek olyan egységes, szilárd alapot, mint az erényetikák.

Mystes 2010.12.10. 00:56:46

@Ghavin: Eltekintve attól, hogy a szentírás nem attól lesz szent, hogy nincs benne ellentmondás, hiszen nem matematikáról vagy formális logikáról van szó, az általad felvetettek semmivel sem vezetnek közelebb a célhoz: Jézus történelmi személy? Igen vagy nem? Erre kell válaszolnunk.

Mystes 2010.12.10. 00:58:40

@Ghavin: Történelmi személyre mítikus elemek rakódhatnak.

ghavin 2010.12.10. 01:04:21

@Mystes: Ha igennel felelek, akkor Akhilleusznak ugyanúgy jár a történelmi alak státusz mint Jézusnak, ezzel együtt a Sztüx-folyóba mártva elért sebezhetetlenség (mínusz a sarok ugyebár) koncepciója alapvetően nem különbözik a feltámadás-mítosztól. Nekem teljesen mindegy, hogy igennel vagy nemmel felelek-e, nekem kurvára nem számít Jézus, ahogyan Akhilleusz sem, a kérdés, hogy TE bevállalod-e így az igen választ.

ghavin 2010.12.10. 01:05:52

@Mystes: És a feltámadás mitikus elem. Jézus előtt is voltak mitológiai és/vagy történelmi alakok akik állítólag feltámadtak.

Goompah 2010.12.10. 01:06:23

@wmiki:

Ma nagyon gyenge vagy, nem szórakoztatsz. Még a hülyeségeid is ötlettelenek. :(

Goompah 2010.12.10. 01:10:44

@maycontainnuts:

"Az evolúcióelméletnek pont ugyanúgy nem eleme se a keresztény Isten, se Jézus, mint ahogy az ID-nek sem."

Az ID-ről ezt nem tudtam. Mindeddig azt hittem, hogy szerintük a tervező valamiféle isten, ha nem is a kereszténység Istene.

Lehet, hogy számukra a tervező nem más, mint valamiféle személytelen céltudatosság a természetben?

Mystes 2010.12.10. 01:20:48

@Ghavin: Én azért vállalom be az igen választ, mert akiknek -akkor- nagyon is érdekükben állt volna azt állítani, hogy Jézus nem létezik, nem tették. Sőt! Tehát én nem az evangéliumoknak hiszek, hanem azoknak, akiknek az nem tetszett!

ghavin 2010.12.10. 01:32:48

@Mystes: Teljesen mindegy, hogy végül milyen idióta indokkal próbálod igazolni, amiért kész tényként kezeled a bibliai jézus létezését és a feltámadás megtörténtét, a nép végén nincs különbség Jézus, Akhilleusz, Ozirisz, Mithrász, Simon mágus meg a többi kismillió "emberbőrbe bújt isten" között. Nem kell magyarázkodnod, te hiszel és kész. Csak kéretik ne szabjuk a megismerés feltételének a válogatott tündérmesékbe vetett hitet.

Mystes 2010.12.10. 06:46:44

@Ghavin: Akkor térjünk vissza az alapkérdéshez: (számodra például) mi a kritériuma annak, hogy valaki történeti lény-e. (Egyelőre) itt tartunk. Ez nem hitkérdés, ez, ha úgy tetszik, egy történettudományi módszertani kérdés. Ez egy tudományos kérdés. Ne keverjük ide sem a feltámadást -amit én nem próbáltam meg igazolni-, sem azt, hogy én például hiszek-e vagy sem. Mert az sem tartozik ide. Erről ne nyilatkozzunk. Nem nyilatkoztam erről én sem, már csak azért sem, mert az (alap)kérdésre nézve irreleváns. Maradjunk a módszertannál.

Mystes 2010.12.10. 06:56:36

@Ghavin: Már csak azért is teszem fel újból és újból a kérdést, mert látom, hogy Te állítasz valamit. Nevezetesen: a nem-történetiséget. Ha pedig ezt teszed, bizonyára valamely kritériumok alapján teszed. Ezeket kellene akkor tisztáznunk. (Amúgy, állításaiddal szemben, én nem állítottam, csak kérdezek!)

Mystes 2010.12.10. 07:08:06

@Ghavin: "Ennek alapján ha létezett is a történelmi Jézus, elég valószínűtlen, hogy kvázi "egybeesett" volna a bibliában ábrázolt varázsló-figurával."

Nos, éppen ez a kérdés:
1., Mik a kritériumai annak, hogy létezett-e.

Egyébiránt azt, hogy -történetileg- egybeesett volna a Bibliában ábrázolt varázsló-figurával, azt senki nem állította.

Tom Benko 2010.12.10. 07:12:49

@wmiki: Én tudom, hogy nem tudja... Csak te vagy túl ostoba, hogy megértsd, szektás!

Tom Benko 2010.12.10. 07:14:06

@wmiki: De az. Az éter létezése önellentmondásokat eredményezett, így még a kitalálói életében elvetették.

Tom Benko 2010.12.10. 07:15:03

@Mystes: Akkor mit keres ebben a témában?

ghavin 2010.12.10. 07:22:37

@Mystes: "(számodra például) mi a kritériuma annak, hogy valaki történeti lény-e. "

Hogy a rendelkezésünkre álló bizonyítékok alapján egyértelműen ki lehessen jelenteni, hogy az adott személy létezett-e avagy sem. Jézus személyét illetően nincsenek közvetlenül rendelkezésünkre álló, kétségbevonhatatlan bizonyítékok, a közvetettek pedig oly mértékben mondanak ellent egymásnak, hogy kábé ugyanakkora az esélye, hogy a bibliában ábrázolt, itt-ott bűvésztrükköket elsütő Jézus-verzió valóban létezett, mint annak, hogy csupán egy kései gnosztikus szekta kitalációja volt az egész história. A két véglet által behatárolt spektrumon pedig számtalan egyéb lehetőség leledzik, amelyek közül bármelyik előfordulhatott. Nem tudjuk, hogy Jézus valóban létezett-e vagy sem, következésképpen nem történelmi alak, csupán egy vallás központi figurája.

Gallis Deece 2010.12.10. 08:36:51

@pounderstibbons:
"Falustól, hogy valaki irányítaná az evolúciót. Azt hogy Isten létrehozta, olyat igen."

"Falus A.-nak szerintem van egy a tudomány jelen állásával összeegyeztethető világképe, mert az ismert evolúciós lépéseket nem vonja kétségbe."

Ugye ezt tegnap munkahipotézisként kezeltük. Kicsit figyelmesebben beleolvastam ebbe a Falus-forrásba itten: ( 5mp.eu/web.php?a=lelkigondozas&o=dhQNPD9s5L )

Azt írja:

"Kérdés: - Hallottam egy előadásban, hogy az embert Isten hibátlannak teremtette, de ma már sok genetikai hibával születünk. Ez a bűneset miatt van így?

Falus A. válasza: - Minden ezredik nucleotidunk "hibás", legalább 3 millió génhibával születünk. Ezek okát a tudomány nem ismeri. Én elfogadom, hogy ez az eredendő bűn miatt van így . . ."

Á, szóval az Isten teremtette, nem-majomőstől származó ember bűnbeesése miatt léteznek mutációk. Mutációk nélkül hogyan volt evolúció? Hmm? Vagy csak "káros" mutációk léteznek a bűnbeesés óta? Ugye tudjuk, hogy a mutációk "károssága" sok esetben környezetfüggő? Vagy csak az emberben nem volt mutáció a Bűnbeesés előtt, az élővilág többi részében igen? És mikor volt ez a bűnbe esés? Százezer, vagy 6000 éve?

No és mi az, hogy "ezek ["genetikai hibák"] okát a tudomány nem ismeri"? en.wikipedia.org/wiki/Mutation#Causes ?? Megint az van, hogy megvédjük szegény hívők lelkivilágát, nehogy gondolkodni kelljen nekik?

Szóval mennyire összeegyeztethető a tudománnyal Falus András krecionizmusa? Hmm?

Falus így folytatja:

". . . de nagyon nem szeretném összekeverni a világnézetet, amely hitet jelent és a tudományt, ami egész más úton , egészen más kérdésekre keres és talál választ. A hit és a tudomány közötti határsértések semmi jóra nem vezetnek. Pusztán hittel nem lehet tudományt művelni, és viszont, tudománnyal nem lehet hitet igazolni. Számomra a hit az elsődleges, de tudományos kérdéseket nem lehet belőle megválaszolni."

Szóval a hit az elsődleges, tudományos kérdéseket nem lehet vele megválaszolni. De Isten teremtette az evolúciót, és senkinek nincs joga azt mondani, hogy ennek nem látjuk semmi bizonyítékát, mert az határátlépés.

Továbbá nyugodtan magyarázzunk félre és hallgassunk el tényeket, nehogy szegény hívők lelki világa sérüljön. Ugye a lelki üdvük előrébb való, mint az ismeretek pontos átadása.

Továbbá nevezzük ki a hitünket evolúciónak, és mondhatunk akármekkora tényektől elrugaszkodott marhaságokat, mindenki tapsolni fog, hogy "dehát hívő, és elfogadja az evolúciót, nézzétek: kompatibilis!!!"

Gratula!

vorosgy 2010.12.10. 08:43:04

@Mystes: Ha hozzászólhatok... egy személy történetiségének elfogadásához nagyban hozzájárulna több, független kortárs beszámoló. Jézus esetében egyetlen ilyenről sem beszélhetünk. Feltehetőleg Máté evangéliuma az egyik legkorábbi beszámoló Jézusról, de az is legalább 20 évvel az ő feltételezett halála után íródott, az íróról pedig szinte semmit nem tudni. A többi kanonikus evangélium pedig ebből keletkezett.

fiziqs 2010.12.10. 09:29:44

@Peter T. Sinclare: A "semmi létezői", az gondolom olyasmi, mint hogy hány angyal fér el egy tű hegyén.
Viszont a "mindentudó" is ilyesmi? Csak egy szókép?

Amúgy meg szerintem az, hogy a természetes kiválasztódás önzéshez vezet, nem igaz. Azt mondanám, hogy önzésre is, de az ellenkezőjére is szolgáltat számtalan példát a természet és a történelem. Ha körülnézünk, számtalan példáját látjuk emberek (állatok, növények) együttműködésének, és ennek "okaként" az evolúcióelmélet az evolúciót jelöli meg. Talán nagy vonalakban: békeidőben megéri önzetlennek lenni, háborúban a szolidaritás köre kisebbre húzódik.

Azt mondod, az erkölcs megalapozásához szükség van Istenre. De különböző közösségek különböző erkölcsi normák szerint élnek, az ő isteneik közül ki mondja meg, melyik az "igazi"?

pounderstibbons 2010.12.10. 09:43:40

@Gallis Deece:
Utóbbi Falus cikket nem ismertem, de van néhány fura mániája a profnak, pl. svindligyanús termékek szakértése:
www.sensolite.hu/szakvelemenyek.html

Viszont ha a bűnbeesés óta van csak mutáció, akkor azt is mondhatnánk, hogy az evolúció akár az Ördög csinálmánya is lehet, és Ádám&ÉVa lehet, hogy nem is a "tudás", hanem az "örökítőanyag hibás másolása" fáról evett.

Ettől függetlenül Falus A.-ban még mindig tudom értékelni, hogy nem akarja átszabni a biológia tantervet, a saját szája íze szerint.
(ha erre is hozol linket, akkor magamban tényleg átteszem kreo-ID kategóriába)

Tardi Grada 2010.12.10. 11:04:49

@Peter T. Sinclare: Az önfeláldozás és az altruizmus, mások segítése nem evolúcióellenes. Már máshol is mantráztam, hogy az elmúlt időszakban szép evolúciós elméletek születtek az emberi altruizmus kialakulására. Nem kéne leragadni az önző génnél. Herbert Gintis írásaira érdemes rákeresni pl.

Gallis Deece 2010.12.10. 11:05:05

@pounderstibbons:

"Ettől függetlenül Falus A.-ban még mindig tudom értékelni, hogy nem akarja átszabni a biológia tantervet, a saját szája íze szerint."

Lehet, hogy most újat mondok, de Michael Behe sem akarja.
www.youtube.com/watch?v=Yx3GaDek98M#t=05m51s

Továbbá Behe legalább annyira elfogadja, ha nem jobban, a közös eredetet, mint Falus András. A fent idézettek alapján akár az is védhető lehet, hogy Behe jobban elfogadja az evolúciót, mint Falus!

Az amúgy katolikus Behe szabad préda, mert azt a saját kreacionizmusát ID-nek hívja, de Falus és társai a ki vannak rakva a kirakatba ("Kompatibilis!"), mert ők ugyanezt "evolúciónak" hívják.

vorosgy 2010.12.10. 11:53:11

@Tardi Grada: Az önző gén elmélete nem mond ellent az altruizmusnak, sőt, alátámasztja azt: azért (is) vagyunk önzetlenek másokkal szemben, mert ők is hordozzák a génjeinket.

Tardi Grada 2010.12.10. 12:10:15

@vorosgy: Bizonyos szempontból ez is igaz, de azért egy kicsit ez bonyolultabb. Az ember olyanokkal is önzetlen és esetenként olyanokért is hajlandó meghalni, akik nem rokonai. Képes feltétel nélkül alávetni magát egy közösség normáinak stb. Ez felvet csoportszelekciós gondolatokat, amik meg nagyon limitált keretek között működhetnek a modellek szerint. Ezért érdekes Gintis modellje, aki matematikailag is megmutatta, hogy a kultúra és a genetikai hatások milyen együttállása tud létrehozni ilyen evolúciós folyamatokat.

vorosgy 2010.12.10. 12:30:15

@Tardi Grada: Nyilván leegyszerűsítettem a dolgokat, és az altruizmust nem lehet egy mondatban elintézni. Két hozzáfűznivalóm van:
- Minden ember a rokonunk, valószínűleg az összes élő ember legfeljebb néhány száz egyed leszármazottja.
- Meghalni másokért (nem a közvetlen rokonainkért) lehet nem célja, csak eredménye az önzetlen ösztöneinknek. Az őskorban, mikor ezek az ösztönök kialakultak, és az emberiség kis csoportokban élt, minden ember, aki találkozott egymással, többé-kevésbé közeli rokon volt. Megtanultunk mindenki más felé önzetlennek lenni, és ez akkor előnyt jelentett az önző gének szempontjából. Ez hasonló a nemi vágy kialakulásához: nyilván a szaporodás elősegítése miatt alakult ki, mégis képesek vagyunk vágyat érezni akkor is, ha fogamzásgátlást használunk.

Gintis munkásságát nem ismerem, tudnál konkrétabb hivatkozást adni, melyik művére gondolsz?

paligreg 2010.12.10. 12:39:57

@Gallis Deece: "Minden ezredik nucleotidunk "hibás", legalább 3 millió génhibával születünk. Ezek okát a tudomány nem ismeri. Én elfogadom, hogy ez az eredendő bűn miatt van így."
Három mondat, három önkényes és önkényesen egymásba fűzött állítás.
A másodikkal és harmadikkal az a baj, hogy az elsőre vonatkoznak, s ha az első csak egy kicsit is nem áll meg, akkor semmi értelmük.
De rendkívülien fülbemászó állításokat tartalmaznak (ez adaj a megjelentetésük értelmét a hitpropagandában): a második elmarasztalja a tudományt, a harmadik pedig hitbéli értékítélet mellett rátesz egy lapáttal a másodikra. Kétségessé teszi a tudományt és minden tudományos megállapítást - igaz, hogy ezt azoknak mondja, akik hajlandók az ő egyéni tekintélyét elismerni.
Mit jelent az, hogy "hibás"? Legfeljebb annyit, hogy az új gén létrehozásakor a másolási folyamat nem csinál pontos másolatot. Miért is csinálna? Pont az evolúció magyarázza meg, hogy mégis miért tűnik úgy, mintha a gének mindig csak "helyesen" másolód(hat)nának le! Az első mondatban ennek mértékét is megmondja a tudomány. A dolgok vannak, nincs okuk. A tudomány feltárja és leírja őket, nem okokat keres. (Persze a jelenségek,a dolgokkal való történések között oksági kapcsolatokat is felfedez, kimutat.)

Gallis Deece 2010.12.10. 12:44:04

@pounderstibbons:
"Falus A.-nak szerintem van egy a tudomány jelen állásával összeegyeztethető világképe, mert az ismert evolúciós lépéseket nem vonja kétségbe."

Hogy ne legyen az, hogy Falus akadémikus urat külön kritikának teszem ki, ugyanez a problémám pl. több magyar természettudománnyal foglalkozó véleményformálóval is, akik minden adandó alkalommal elmondják, hogy "kompatibilis" mert pl. a katolikus egyház, és a pápa (II.JP) elfogadja az evolúciót ("több, mint hipotézis").

Ami persze megint jelentős tévedés, mert amit a kat. egyház és a pápa elfogad, az megint nem az evolúció tudományos elmélete, továbbá szembe megy az idegtudomány, neuropszichológia és evolúciós pszichológia (hogy csak néhány biológiával rokon területet említsek) összes eredményével.

"Theories of evolution which, because of the philosophies which inspire them, regard the spirit either as emerging from the forces of living matter, or as a simple epiphenomenon of that matter, are incompatible with the truth about man." II. JP

Ez ugye nem az evolúció tudományos elmélete.

És amikor egy tudóstól, vagy akár a szkeptikus társaságtól olyan kijelentéseket hallok, hogy "Hurrá!" ez "kompatibilis" akkor az a véleményem, hogy ezzel szimpla ismerethiányból fakadóan, vagy a PC kedvéért semmibe veszik azoknak a kutatóknak a munkáját és eredményeit, akik a hagyományosan "léleknek" tulajdonított jelenségek tanulmányozásával foglalkoznak.

Tardi Grada 2010.12.10. 12:48:53

@vorosgy: Amit írsz az tökéletesen igaz, ha közeli rokonok, vagy klónok élnek együtt, de ha nem közeli rokonok, akkor a hagyományos modellek befuccsoltak. Ez persze nem ellenérv a hagyományos neodarwini szelekciós mechanizmus ellen, hanem annak egy kiterjesztése és ezért érdekes. Mert akik vulgárisan kezelik a szelekciós folyamatokat, azok jutnak oda, hogy az evolúció "embertelen" állapotokhoz vezetne. Ezért is idézgetem ezeket az eredményeket :)
itt egy link a wikipediáról, ahol az eredeti hivatkozások is megvannak.
en.wikipedia.org/wiki/Group_selection#Group_selection_indicated_by_gene-culture_coevolution

zaza42 2010.12.10. 13:51:24

Haha, az értem honlapján (ertem.hu/page/eltalalnad-e-szazszor-a-sotetben-a-celt-49/ ) levő scrabble-es példa igazából egy becsapós feladvány. Meg is fejtem gyorsan, figyeljetek, előbb idézek:

>>>>>
"87évvelezelőttapáinkegyÚjszabadságbanfogantnemzetetHívtakéletreezenaföldrészen"

A barátod azt állítja, hogy ez a mondat úgy született, hogy véletlenszerűen a Scrabble (betű-szó-összerakós játék) elemeit húzta ki egy zacskóból. Hinnél neki? Feltehetően nem. De vajon miért nem?
<<<

Válaszolok: azért nem, mert a scrabble-ben csak betűk szerepelnek (ezért szójáték), így a 8-as és a 7-es számjegy még ultrabrutál véletlenek révén se lehetett volna a zsebében. :> Nemtom, ezt hogy nem vettétek észre!!! :->

De aztán még szebb:
>>>>>>>>>>
De nem csupán erről van szó. Ha a barátod az alábbi karaktereket mutatta volna, akkor valószínűleg te is, és mindannyian hinnénk neki.

"lpeáintÚőrézbedbaygasávzazlakleé7vsnetélmtvtenozfdeeseHkeí8aöeretgatejfntnazgn"
<<<<

Ki hinne annak, aki scrabble-ös betűkből egy 7-es számot és kisbetűket is ki tud húzni? Szerintem csakis azok, akik teleírnak egy ertem.hu honlapot olyan ökörségekkel, hogy a 10éves húgom is sikítozna a scrabble mellett a röhögéstől...ha létezne, de nincs húgom.

pounderstibbons 2010.12.10. 14:20:42

@zaza42:
Ha sokat gondolsz rá, akkor majd tervez neked húgot a tervező.
(de ne imádkozz, mert az olyan maradi kreós dolog, nem pedig trendi, mint az ID)

Gallis Deece 2010.12.10. 14:25:22

@Gallis Deece:
@pounderstibbons:
@paligreg:

Bár nem is tudom, miért csodálkozok, amikor a fél Akadémia teológiai konferenciákon "kompatiblilizálja" a vallást a tudománnyal, ilyen végkövetkeztetésre jutva, mint:

"A konferencia szerint az agresszív (azaz a vallást elutasító) ateizmus és az agresszív (a tudományt elutasító, amerikai eredetű) teremtéselmélet („kreácionizmus”) két, egyformán szélsőséges, egyformán elutasítandó nézetrendszer."

Meg "Korunk álvallási és áltudományos szellemi szennyáradatának gátja az ilyen értelemben egymással szövetséges tudomány és vallás. "

Ugye használható definíciót az álvallás kifejezésre sosem adtak, és így kénytelen vagyok azt hinni, hogy "álvallás" az az a vallás, ami nem az ezt a kijelentést tévő személyek saját, külön bejáratú vallása. LOL.

zaza42 2010.12.10. 14:41:51

Ja, de egy dolog kiderült: az ID-sek nem scrabble-öznek! Végre egy valamennyire alátámasztott tény az ID-vel kapcsolatban. Nemtom, ez hova vezet, de legalább így lehet mégegy mondatuk a "tervezte és kész" mellett. Így már duplaannyi ténymegállapításuk lehet, ami a statisztikában ugyancsak jól mutat.

pounderstibbons 2010.12.10. 14:49:47

@Gallis Deece:

Én sem tudom miért csodálkozol. :)

A Társaság azonban nem foglalkozik vallásokkal.
Ugye jelen vitában sincs egy csepp vallás sem, mégis egy általam szinte kibogozhatatlan teológiai-jellegű vita bontakozott ki belőle.
Tényleg nem értem miért.

Szerintem a vallásos hit, nem igazán megkülönböztethető a sportegyesületek iránti rajongástól, emiatt talán kevésbé zavar mint másokat.
Mit érdekel engem, hogy ki kinek szurkol, amíg nem zavar engem ezzel?
A tudomány állását se módosítja, hogy ki nyeri a BL-t, mint ahogy az sem, hogy melyik vallás, hogyan jobb a másiknál.

Ha viszont a történelemórára akarnák bevezetni, hogy Albert Flórián élete legyen ugyanolyan hangsúlyos, mint Nagy Lajosé, az ellen tiltakoznék.

Gallis Deece 2010.12.10. 14:57:35

@pounderstibbons:

"A Társaság azonban nem foglalkozik vallásokkal."

Egy fenéket nem foglalkozik, abban a pillanatban, amikor bármelyik tagja leírja, kimondja, arra utal, hogy valakinek a vallása, vagy pl. bizonyos felekezet, pl. a katolikus "kompatibilis", rányomja a jóváhagyás pecsétjét az adott vallásra.

Politikailag kifizetődő vagy sem, ez teljes mértékben intellektuálisan őszintétlen.

Ha a szkeptikus társaság tényleg nem foglalkozik vallásokkal, akkor legyen szíves hanyagolja ezeket a kijelentéseket, különben így jár, mint most Falus Andrással pl.

KenSentMe 2010.12.10. 15:14:45

@Gallis Deece: Az, hogy a társaság nem foglalkozik vallásokkal, az szerintem tényleg azt jelenti, hogy mintegy jóváhagyja őket. (Hiszen amit nem hagy jóvá a szkeptikus társaság, az ellen felemeli a hangját.)

De ez miért őszintétlen intellektuálisan? Fordítsuk meg a kérdést.. szerinted egy szkeptikus felfogású ember nem lehet hívő?

pounderstibbons 2010.12.10. 15:16:47

@Gallis Deece:

ad 1. Én nem vagyok a Társaság. Bármilyen kijelentésem csak és kizárólag az én véleményem.
Bármely egyház tagjának véleménye se értelmezhető az egész egyház véleményeként, talán csak ha pápa az illető.

ad 2. Falus Andrást az Értem ráncigálja elő szövegkörnyezetéből kiragadott idézetével, és próbálja úgy bemutatni, mint a naturalizmust bíráló naturalistát.
Vagy tudósokat bíráló tudóst.

ad 3. Őszintétlen a Társaság akkor lenne, ha fogná az evolúciót dícsérő szövegrészeket valamelyik Falus cikkből (ahogy az Értem)és kitenné a honlapjára méteres betűkkel : MÉGSEM ÜTKÖZIK A HIT A TUDOMÁNNYAL! FALUS ANDRÁS MEGMONDJA A TUTIT! HALLELUJA, HALLELUJA!

Gallis Deece 2010.12.10. 15:22:16

@VRbagoly:
"Az, hogy a társaság nem foglalkozik vallásokkal, az szerintem tényleg azt jelenti, hogy mintegy jóváhagyja őket."

Ezt írtam? Nem ezt írtam. Ezt írtam:

>bármelyik tagja leírja, kimondja, arra utal, hogy valakinek a vallása, vagy pl. bizonyos felekezet, pl. a katolikus "kompatibilis"

Ha nem foglalkozik vallással, akkor ne foglalkozzon a vallással. Ne utaljon rá, hogy valakinek a vallása tudományos szempontból "jó", vagy valamelyik vallás "jó", jobb a többinél.

Mert elvileg a társaság nem foglalkozik a vallással, ugye?

@VRbagoly:
"De ez miért őszintétlen intellektuálisan? "

Írtam fentebb:

A PC jegyében kirakatba tenni <bárkinek a vallását, bármelyik vallást>, mint "lám, lám, kompatibilis", és nem megemlíteni a ténynek a második felét, miszerint bármilyen természeti jelenségre az mondani, hogy "Isten csinálta", az ebben az értelemben kompatibilis a tudománnyal, az intellektuálisan őszintétlen.

Gallis Deece 2010.12.10. 15:37:19

@VRbagoly: "Fordítsuk meg a kérdést.. szerinted egy szkeptikus felfogású ember nem lehet hívő?"

Nézd, ez ne legyen az én problémám. Legyen ez a hívő szkeptikus, meg a Szkeptikus Társaság problémája, ha jelentkezik tagnak.

Feltételes módban: viszont ha ez a hipotetikus "hívő szkeptikus" tudományos fogalmakkal dobálózva akarja nekem eladni, hogy Isten indította be/irányítja az evolúciót, vagy hogy ezésez az egyház elfogadja az "evolúciót", akkor engedtessék meg nekem, hogy azt mondjam: na ne.

pounderstibbons 2010.12.10. 15:39:56

@Gallis Deece:
"A PC jegyében kirakatba tenni <bárkinek a vallását, bármelyik vallást>, mint "lám, lám, kompatibilis", és nem megemlíteni a ténynek a második felét, miszerint bármilyen természeti jelenségre az mondani, hogy "Isten csinálta", az ebben az értelemben kompatibilis a tudománnyal, az intellektuálisan őszintétlen. "

Szerintem ebben egyetértünk. Nem is került ki cikk ide Falus András hiedelemvilágáról.

Az, hogy a kommentek között szerepel, az annak köszönhető, hogy valaki aki megtalálta (de nem társaságtag tudtommal) azt mondta, hogy neki tetszik az Id-közeli idézet tőle. Mire én beklinkeltem a teljes cikket, ami alapján világos, hogy az ID valahogy elfelejtette közölni a számára kínos részleteit a cikknek.

KenSentMe 2010.12.10. 15:45:54

@Gallis Deece:

>>"Az, hogy a társaság nem foglalkozik vallásokkal, az szerintem tényleg azt jelenti, hogy mintegy jóváhagyja őket."

Ezt írtam? Nem ezt írtam.<<

Ezt valóban nem írtad. Ezt ugyanis én írtam! Az, hogy a társaság nem foglalkozik vallásokkal, az nagyrészt egy tény, az pedig, hogy "szerintem", jelzi, hogy az utána következő dolgok az én véleményeim. Semmi sem kötelez reakcióra engem, általában a saját agymenéseimet írom le. És ahelyett, hogy reagálnék, simán kezdeményezhetek beszélgetést egy általam érdekesnek talált témában (pl. hogy szerinted a szkeptikus felfogásból következik-e logikailag az ateizmus).

>>bármilyen természeti jelenségre az mondani, hogy "Isten csinálta", az ebben az értelemben kompatibilis a tudománnyal<<
Ha jól értem (tehát itt most tényleg megérteni akarlak), az a bajod, hogy a katolikus egyház bizonyos hivatalos nézeteit nem lehet a tudománnyal összeegyeztetni. (Legalábbis erre hoztál érveket.).

Amiből adódik a kérdés, hogy magát az egyházat kell-e bírálni/támadni ezért, másrészt, hogy a hívő, aki magában éli meg a hitet, az összeegyeztetheti-e valahogy mégis magában a személyes katolikus hitét a tudománnyal. Míg az előbbi kérdés esetén hajlok egy "igen" válaszra, addig az utóbbiban bizonytalan vagyok. Nem tudnék rá "nem-nem-nem"-el felelni:). Ha ő ezt meg tudja csinálni, az nem ugyanúgy reklám a többi hívő felé, hogy ti is olvashattok tudományos folyóiratokat, nyugodtan gondolkodhattok és vitatkozhattok, mert én is megtehetem?

Gallis Deece 2010.12.10. 16:11:28

@VRbagoly: "Ezt valóban nem írtad."

Ez azért volt, mert mintha valami olyasmivel vitáztál volna, amit én nem állítottam.

"Amiből adódik a kérdés, hogy magát az egyházat kell-e bírálni/támadni ezért, másrészt, hogy a hívő, aki magában éli meg a hitet, az összeegyeztetheti-e valahogy mégis magában a személyes katolikus hitét a tudománnyal. "

Nem. Nem kell az egyházat támadni. Stick to the science. A felvetést kell támadni.

példa:

X Egyház: A világ 6000 éves

Válasz:

1) Nemhívő Társaság: A világ minden ésszerű kételyt figyelembe véve nem 6000 éves. Itt a magyarázat, hogy miért. Ez alapján kijelenthető, hogy X Egyház ezen tanítása téves.

2) Tudományos ismeretterjesztéssel foglalkozó, vallással nem foglalkozó társaság: Az a kijelentés, miszerint a a világ 6000 éves, minden ésszerű kételyt figyelembe véve nem állja meg a helyét. Itt a magyarázat, hogy miért.

3) Tudományos Kompatibilitás Társaság: Az a kijelentés, miszerint a világ 6000 éves, minden ésszerű kételyt figyelembe véve nem állja meg a helyét. Itt a magyarázat, hogy miért. Nem minden hívő osztja azonban a 6000 éves világ nézetét, Y Egyház főprófétája hivatalos kinyilatkoztatásában fogadta el a világ mai korát, és itt van Gipsz Jakab, mélyen hívő Z-tudatú geológus, aki ugyancsak kompatibilisnek tartja a jelenlegi tudományos nézettel azt a hitét, hogy Z teremtette a világot.

Joaquin 2010.12.10. 16:15:40

@Tom Benko: ez nem igaz, az éter megállná a helyét a mai fizikában is, olvastam is olyan fizikus munkáját, aki mániákusan beleszerkesztette minden elméletébe és ettől még az elmélet konzisztens maradt. Nem meglepő, hisz maga Lorentz is úgy képzelte, létezik. Az elmélet Occam borotvája miatt került ki a fizikai elméletekből, és mivel a fizikai elméletek nélküle is működnek, minek bonyolítsuk a képleteket? (Javíts ki ha tévedek, lehetséges, hogy a húrelmélettel már ellentmondásban van, arról semmit sem tudok)

Tom Benko 2010.12.10. 20:46:17

@Joaquin: Jánossy? Érdemes elolvasni Novobátzky véleményét az elméletről. Sajnos az éter tényleges önellentmondásokat tartalmazott, illetve generált. Húrelméletet én sem ismerem sajnos eléggé, de igyekszem pótolni...

Mystes 2010.12.10. 21:44:55

@vorosgy: Minek egy nem történeti (mítikus?) személy "halála után 20 évvel" írni róla? Felejtős! :)

Egyébként: Márk a legkorábbi

Mystes 2010.12.10. 21:47:49

@Ghavin: "Nem tudjuk, hogy Jézus valóban létezett-e vagy sem, következésképpen nem történelmi alak".

Örülök, hogy ilyen (módszertani?) következtetésre jutottál. Engem is nagyon zavar/na Jézus történetisége! Ezennel azonban elköszönök, mert tényleg nem ez ennek a posztnak a témája, és félrevinnénk a beszélgetést.

lacalaca · http://cydonia.blog.hu 2010.12.10. 21:55:24

@Joaquin: nemnem, a Michelson-Morley kísérlet kimutatta, hogy az éter, mint abszolút koordinátarendszer megtestesítője illetve a fényhullámokat biztosító közeg nem létezik. Ugyanis ha a fény az éterben terjedő hullám lett volna, eltérést kellett volna mérniük a különböző irányokban fellépő fénysebességben a Föld mozgása miatt. Nem volt, mivel éter sincs. Lorentz pedig egyszerűen egy konzervatív magyarázatot adott jelenségekre, mivel még ragaszkodott egy abszolút koordinátarendszerhez (ami Newton óta nagy sláger volt). Aztán a specrel enélkül a feltétel nélkül megoldotta a feladatot.

Nyilván vannak dolgok, amikbe be lehet hegeszteni az étert, ahogy a geocentrikus rendszer a maga bonyolultságával egész jó közelítéssel leírja a bolygók látszólagos mozgását az égen. De attól még tudjuk, hogy nem a Föld van a középpontban, miután ismerjük a gravitációt, ami csak akkor működik jól, ha a Nap van a középpontban.

Bobby Newmark 2010.12.10. 22:08:12

@Mystes: Épp most akartam egy hitedet megalapozó óriási tévedésedre felhívni a figyelmed...

Mystes 2010.12.10. 22:33:58

@Bobby Newmark: Kedves Newmark. Minden tévedés kiküszöbölése haszonnal jár! De mi nem hitről beszélgetünk, hanem történelemtudományi módszertani kérdésekről. Pl: milyen kritériumok alapján mondhatjuk valakiről, hogy történeti. Erre megszületett a válasz Ghavintól, amit be is idéztem. ("Ha nem tudjuk valakiről, hogy létezett-e vagy sem, akkor nem történeti.") Világos. Kell ennél több?

pounderstibbons 2010.12.10. 22:49:48

@Mystes:
Ráadásul vannak emberek, akiknek létezését nem is vitatja szinte senki, mégis a történelemtudomány érdekes dolgokat tárt fel velük kapcsolatban. Leginkább a nemlétezésükről...

Itt van egy híres önfeláldozó hős, negyedannyi idő távolságban, mint Jézus (igaz nem támadt fel, már ha élt egyáltalán), viszont szimpla 20.000 Ft-os kérdés volt a neve a Legyen Ön is Milliomosban:
www.mult-kor.hu/20090619_igy_lett_romantikus_nemzetkepunk_hose_dugovics_titusz

Bobby Newmark 2010.12.11. 01:06:30

@Mystes: Nem arra gondoltam, hanem erre:

"Viszont azért a krisztushit eléggé zavarhatott bizonyos zsidó (és nem zsidó) köröket ahhoz, hogy simán a hívők képébe vágják, hogy: ugyan miről beszéltek ti, hiszen Jézus 'egy mítosz"! Mégsem tették. Vajon miért? Sőt, nemhogy nem tették, hanem ők maguk állítják indirekte, hogy Jézus történelmi személy azzal, hogy mondják: Jézus holttestét ellopták (a hívők). Egy mítosz holttestét nem lehet ellopni..."

Itt valamit totál félreértesz.
1. Nyilvánvaló, hogy életében (tehát a kortársak) nem nyilatkozhattak a feltámadásról, mert ugye az az életének a vége után történt állítólag.
Innentől kezdve igencsak irreális az elvárásod, hogy kortárs zsidók ellenkezését várd.

2. Mégiscsak emlegeted, hogy a zsidók letudták annyival, hogy a holttestet ellopták, de ez nyilván már csak akkor történt, amikor a kereszténység jelentősen elterjedt, és nyilatkozatra kényszerítette az ortodox zsidókat. De ez egyben azt is jelenti, hogy a zsidók olyan gyorsan reagáltak, amint csak lehetséges. Nem értem, milyen ellenvélemény hiányáról, vagy késlekedésről beszélsz.

3. Ha azt állítják, hogy a holttestet ellopták, azzal _PONTOSAN_ azt mondják, hogy "az csak egy mítosz". Pontosan azt, amit te vársz. Ezt hogy lehet, hogy nem érted?
Ellopták a holttestét -> tehát nem támadt fel -> tehát az egész csak egy kitaláció, mese, mítosz.

4. Emellett ebből még egyáltalán nem eldönthető, hogy Jézus történelmi személy volt-e. Előbb beláttuk, hogy ez már a kereszténység teljes értékű vallássá válása után történt, tehát legalább néhány száz évvel Jézus élete után történt, így azok az emberek, akik ezt az állítást tették, maximum az evangéliumokban (még a szájhagyomány útján terjedő változatban, Újszövetség összeszerkesztése előtt) találkozhattak Jézus személyével. Tehát semmivel sem voltak kompetensebbek annak a megítélésében, hogy létező személy volt-e, vagy teljes egészében kitalált.

Szal elnézést, ha ezzel a lelkedbe gázolok, de úgy összességében nem sok értelme van annak, amit beszélsz.

Peter T. Sinclare 2010.12.11. 13:17:10

@Bobby Newmark: @pounderstibbons:

1. Dugovics Titusz nem vallásalapító. Történelmi mellékalak. Sokkal egyszerűbb beleszőni az alakját a valós eseményekbe, mint egy vallásalapítóét.

2. Kortárs feljegyzések híján sok vallásnak egyáltalán nem létezett volna alapítója a ti logikátokat követve, ahogy az egyiptomi, vagy sumer királylista sem hiteles, mert sok név csak ott szerepel először

3. Jézus halála után nem sokkal már tetemes írásos anyag születik a követői részéről, és pl. a Jézus-mondások rendkívül népszerűek voltak

4. Az, hogy a sok szerkesztésen átesett evangéliumok a 4. század során kapják meg végső formájukat, nem jelenti azt, hogy ne léteztek volna kezdetleges formában már J halála után néhány évvel

5. Számos önjelölt messiás működött J előtt, alatt és után is.

6. A J alapította gyülekezet létezett.

7. Számos követője maradt az után is, hogy nyilvánvalóvá vált, nem tér vissza egyhamar

Tegyétek össze ezt a hét közvetett bizonyítékot, és egyértelmű lesz, hogy létezett egy Jeshua nevű reformer rabbi, aki magát a Megváltónak tekintette, híveket gyűjtött, közösséget épített, majd letartóztatták, és államellenes összeesküvésért keresztre feszítették.

Peter T. Sinclare 2010.12.11. 13:20:00

@Ghavin: Ha valakinek a léte nem bizonyított, máris nem lesz történelmi személyiség?

Akkor máris hiány van néhány milliárd emberből, akik az elmúlt néhány tízezer évben haltak meg :)

Peter T. Sinclare 2010.12.11. 13:22:29

@Tardi Grada: Nem is mondtam, hogy az volna! Csak én meghatároztam a kereteket, amiken belül előnyös evolúciós szempontból. Ez a gyakorlati közösség. Nem pedig a humanisták és liberálisok elvont faji közösség, az emberiség!

Az emberiség szintjén kifejezetten hátrányos az altruizmus, mert akkor éppen a te vérvonalad nem adódik tovább, tehát az altruizmusodat sem örökíted tovább.

Peter T. Sinclare 2010.12.11. 13:35:19

@fiziqs: "A "semmi létezői", az gondolom olyasmi, mint hogy hány angyal fér el egy tű hegyén.
Viszont a "mindentudó" is ilyesmi? Csak egy szókép?"

A mindentudó részben teológiai fogalom, részben egy gondolatjáték szereplője. Kb. olyan, mint a mi történne, ha a mindent oldó savat a mindennek ellenálló edénybe tennénk.

A vita arról szól lényegében, hogy az idő természetétől függően vagy tényleg mindent tud, de nem tudja biztosan, mi fog bekövetkezni, vagy mindent tud, de nincs választás az idő természete szerint.

"Amúgy meg szerintem az, hogy a természetes kiválasztódás önzéshez vezet, nem igaz. Azt mondanám, hogy önzésre is, de az ellenkezőjére is szolgáltat számtalan példát a természet és a történelem. Ha körülnézünk, számtalan példáját látjuk emberek (állatok, növények) együttműködésének, és ennek "okaként" az evolúcióelmélet az evolúciót jelöli meg. Talán nagy vonalakban: békeidőben megéri önzetlennek lenni, háborúban a szolidaritás köre kisebbre húzódik."

Erre írtam, hogy a gyakorlati közösségen belül az altruizmus rendszerint kifizetődőbb, emberiség, vagy nemzet szintjén már az önzés az, ami segít a túlélésben.

"Azt mondod, az erkölcs megalapozásához szükség van Istenre."

Kizárólag a teista rendszerekben :)

"De különböző közösségek különböző erkölcsi normák szerint élnek, az ő isteneik közül ki mondja meg, melyik az "igazi"?

Ezt bízd az adott teista közösségre. ;) amúgy az a tendencia, hogy ha vallási váltás következik be, az előző istengeneráció a háttérbe szorul, vagy demonizálódik.

Peter T. Sinclare 2010.12.11. 13:45:27

@Ghavin: "Ez így baromság. 1) egyenlőségjelet teszel az optika és történelemkutatás közé, ami nettó dilettantizmus 2) figyelmen kívül hagyod, hogy egy koncepció olykor függetleníthető a koncepció hatásától, ami bruttó csőlátás. Kár, amúgy egész csinos költői kép lett volna."

Ezt így nem értetted meg.
1. nem egyenlőségjelet tettem, hanem egy másik tudományterületről hoztam példát, illusztrálni. Azt, hogy közvetett bizonyítékok alapján is ki lehet mondani, valaki létezett-e, vagy sem.
2. miért hagynám figyelmen kívül? Éppen te nem veszed észre, hogy a függetlenítés kb. a marginális koncepciók esetében működik. A világtörténelmet meghatározó személyek rendszerint léteztek, maximum nem úgy, ahogy a hívek/utókor lefesti. Lásd: Buddha, vagy Lao-ce.

"1) Pedig simán, elég megnézni, hogy a vitatott korban a számos messiás mellett hány olyan kultusz létezett, ahol nem isteneket, hanem isteni manifesztációkat imádtak."

Éppen a számos messiás erősíti azt, hogy simán élhetett Jézus is. Ha csak ő mondta volna magáról, hogy messiás, akkor gyanakodhatnánk.

Az isteni manifesztációnak akkor is kellett hordozója legyen. Vagy szerinted nem léteztek az egyiptomi fáraók, csak mert Hórusz manifesztálódott bennük az egyiptomiak hite szerint?

"A történelmi alak (a valóban élő személy) nem esett egybe a manifesztálódó istennel, hanem a kettő egyesülése képezte az imádat tárgyát (Ízisz, Mithrasz-kultusz, satöbbi)"

ÉS?! Mi itt a történelmi Jézusról vitázunk, nem a vallás Jézusáról!

"2) Ennek alapján ha létezett is a történelmi Jézus, elég valószínűtlen, hogy kvázi "egybeesett" volna a bibliában ábrázolt varázsló-figurával. "

Azt hittem, világos, hogy a történelmi személy az történelmi személyt jelent és nem vallási-mitikus személyt :D

Tardi Grada 2010.12.11. 13:53:55

@Peter T. Sinclare: Az első bekezdésben igazad van, csakhogy tudtommal pont a kereszténység az aki ugye szintén az egész emberiséget magához öleli. Még az ellenségeit is. etc Aztán ott a buddhizmus is. Szóval nem csak a fránya liberálisok és humanisták bűne az emberiség egyenlő kezelésének mániája. Mellesleg a humanizmus és a liberalizmus részben a kereszténység köpenyéből bújt ki, mégha sok dologban ellene is megy. Szóval szerintem a humanizmus nem ösztönellenes, hanem a környezet hatására az evolúviósan adott ösztön "túláltalánosít", bár nem vagyok benne biztos, hogy ez baj...

Mystes 2010.12.11. 13:56:40

@Bobby Newmark: Kedves Bobby. Látom, nem hagyod, hogy visszavonuljak, hiszen válaszod oly részletes és megtisztelő, hogy nem lenne tisztességes hallgatással elsiklani felette. Lássuk pontonként:

1. Nyilván nem a kortárs zsidók tiltakozását várom el. De, még egyszer: nem a feltámadásról beszélgetünk! Válasszátok már el légyszíves! Arról beszélünk, hogy Jézus élt-e! Ebben az értelemben, a kortárs zsidók sem tiltakoztak az ellen, hogy Jézus élt volna. Az evangéliumok tele vannak olyan történetekkel, ahol Jézus hús-vér személyként jelenik meg. A vita nem azon folyik, hogy ő él-e, hanem a személyének, cselekedeteinek az interpretációján.

3. A holttest ellopásával való érvelés elég gyors érvelés kellett, hogy legyen, közvetlenül az események után. Ha ez az érv, és nem az, hogy "Jézus csak egy mítosz", akkor az azt bizonyítja, hogy épp az ellenségek ismerték el: Jézus történelmi lény. Szó sincs "mítoszról". És, itt megint ismételnem kell: nem a feltámadásról beszélünk, csak arról, hogy Jézus történelmi személy-e vagy nem. A feltámadást persze, hogy tagadják!

4. Az előbbiek fényében súlytalan a továbbiakban azzal érvelni, hogy Jézus mégsem történeti személy, mert hogy mindezt "később írták le". Nyilván később írták le. Miért, mikor írhatták volna le? Előbb?

Üdv

Tardi Grada 2010.12.11. 14:04:02

Nem teljesen értem, hogy miért olyan fontos kérdés itt most, hogy létezett-e Jézus.
Aki hisz benne, az elhiszi azt is, hogy feltámadt, meg azt is, hogy létezett. Aki nem hisz, az főleg abban nem hisz, hogy feltámadt és a csodáiban. Tehát kár ezen annyira rugózni, hogy élt-e. Van rá egy-két független írásban utalás, szóval lehetnétek nagyvonalúbbak :) A csodák és a feltámadás kérdése az már nehezebb ügy, de az pont olyan mint a teremtés. Nem vizsgálható, tehát hit kérdése.

Mystes 2010.12.11. 14:09:13

@Bobby Newmark: Talán még annyit tennék, hozzá, hogy a hívők állításaival szembenállók, bármit is mondtak, nevezetesen, hogy:
1., A holttestet csak ellopták
2., Ergo: nem támadt fel
MINDKÉT állításban implicit benne van, hogy Jézus történelmi személy! Nem azért gondolom tehát, hogy Jézus történelmi személy, mert a benne hívők ezt állítják, hanem azért, mert akik nem hisznek benne/neki, azok sem tagadják, sőt. Megerősítik!

Mystes 2010.12.11. 14:12:21

@Tardi Grada: Egy szkeptikus sosem lesz "nagyvonalú"! Annak minimum dogmatikusnak kell lennie. Az még a saját (személyes) létezésében sem hisz :)

Mystes 2010.12.11. 14:17:05

@Mystes: Egyébként: miért is kellett azt mondani, hogy a holttestet ellopták? Mivel, az ellenérdekeltek nyilván azonnal kimentek a sírhoz, hiszen a holttest megléte lett volna a bizonyíték arra, hogy a hívők halandzsáznak. Viszont: megállapították, hogy a (holt)test nincs ott. EZÉRT kellett azt mondani, hogy a testet ellopták (a hívők). Valamit már csak kellett mondani, nem? Hiszen, mindenesetre annyit meg tudtak, hogy ők meg nem voltak.

Tardi Grada 2010.12.11. 14:57:07

@Mystes: Nono! Itt az ellenpélda. Bár ahogyan mondod, a létezésem tényleg nem 100% :)
Szóval szerintem tényleg nem az a nagy kérdés, hogy Jézus létezett-e, hanem, hogy az amit az emberek neki tulajdonítanak az igaz-e. Illetve mi az, ami tényleg hit kérdés, tehát illik benne kételkedni. Egyébként szerintem még hívőként is lehet kételkedni. Pl. Elhiszem, mert hasznosnak érzem, vagy tetszik, de tudom, hogy ez bizonytalan. Mint Pascal. :)

Mystes 2010.12.11. 15:20:53

@Tardi Grada: Szóval, arra a kérdésre, hogy Jézus pont ugyanolyan történelmi személy, mint mi, csak igennel vagy nemmel lehet válaszolni. Vagy igen vagy nem. Ez nem hitkérdés! :)

(Történettudományi) módszertani kérdés (még) lehet. Ezekre (viszont) próbáltam válaszolni.

Tardi Grada 2010.12.11. 15:34:46

@Mystes: ööö, no nem akarok belemenni. Igazad van: vagy igen, vagy nem :) de egyszerre. Szóval kéne egy történelemtudós, hogy az eddigi kutatások alapján a történelemtudomány milyen valószínűséggel (az előző két szó aláhúzandó, kiemelendő) fogadja el illetve utasítja el Jézus létezését. Aztán 2 év múlva lehet, hogy lesz 3 új irat, ami alapján nő a valószínűsége, vagy kiderül, hogy valami hamisítvány és csökken... Nekem ez az érzésem a történelemtudomány logikájáról. A fekete-fehér/igen-nem válasz annak fontos, aki valami miatt érdekelt az eredményben.

KenSentMe 2010.12.11. 15:37:51

@Mystes: Ez annyiban jó megjegyzés, hogy aki ilyet állít, az valóban elismeri, tehát nem fejezte ki elég pontosan magát (vagy akaratlan nyelvbotlásból, vagy tudattalan koncepciójából). De én pl. sosem állítottam, és ezentúl nem is állítanék ilyesmit:). Úgy is mondhatnám: ez nem univerzális érv, csak azokra vonatkozik, akik ilyesmit állítanak (és ők is védhetik magukat utólag azzal, hogy nem gondolták át ezt az implicit kijelentést).

@Peter T. Sinclare:
"Az emberiség szintjén kifejezetten hátrányos az altruizmus, mert akkor éppen a te vérvonalad nem adódik tovább, tehát az altruizmusodat sem örökíted tovább."

Szerintem ezt a mondatot elrontottad. Összekeverted az egyént az emberiséggel. Az egyén szintjén ugyanis bizonyos szempontból lehet hátrányos az altruizmus. Ha én altruista vagyok és nem az én vérvonalam öröklődik tovább, akkor számomra valóban hátrányos az, hogy kihalok. De az >emberiség< egészének szintjén kifejezetten előnyös az én altruizmusom: hiszen ha én altruista vagyok, akkor lehet, hogy az egész emberiség pont énmiattam nem fog kihalni.

(Tehát: ami az egyén szempontjából hátrány, az lehet az egész szempontjából előny.)

Mystes 2010.12.11. 15:47:33

@VRbagoly: Ha egy MAI zsidót/ellenzőt, mohamedánt kérdeznénk meg, az sem azzal vitatkozna, hogy Jézus élt-e. Tehát nem érv az, hogy az akkoriak azt sem tudták, mit beszélnek. A maiak sem tudják?

Egyébiránt a saját módszertant kidolgozó modern történettudomány sem gondolja egyáltalán, hogy Jézus nem történelmi személy. Olyasmit állítani, hogy Jézust valamiféle mondai/mítoszi elemekből "rakták össze", a szovjet típusú valláskritika tudott csak produkálni a legrosszabb időszakaiban.

Mystes 2010.12.11. 16:07:27

@Mystes: De hát persze "a tudománnyal" sem akarok érvelni, hiszen minden tudománynak megvan a maga filozófiai prekondíciója, előfeltevései. Az igazán érdekesek nem a tudomány "eredményei", hanem mindig ezek az alapfeltevések.

Nekem jelen esetben inkább azzal van vitám, hogy legyünk szkeptikusok - szkepticizmusért. Bravo. Csak éppen minek? A szkepticizmus a(z abszolút) cél, ahová el akarunk érni/jutni, vagy inkább csak egy intellektuális attitűd (mert módszertannak azért nem mondanám), amivel azt akarjuk elérni, hogy ne higgyünk/fogadjunk el semmit/bármit, csak kritikával. Ebben az esetben támogatom. De amikor abszolútummá próbálja kinőni magát, és "a szkeptikuson" már semmilyen érv nem segít, akkor maga a szkeptikusság válik 'hittétellé'.

Bobby Newmark 2010.12.11. 16:32:25

@Mystes: Továbbra sem érted, vagy nem akarod érteni.

"De, még egyszer: nem a feltámadásról beszélgetünk! Válasszátok már el légyszíves!"

Nem elválasztható. Jézus a feltámadástól lett Isten fia. Ha a feltámadásos mese nincs, akkor egy utolsó jelentéktelen kis zsidó rabbicska marad, mint az összes többi, akiknek ma nem tudod a nevét és akikről nem is tudsz.

"Ebben az értelemben, a kortárs zsidók sem tiltakoztak az ellen,"

Továbbra is értelmetlen, amit mondasz, a kortársak nem tiltakoztak, mert nem volt mi ellen. Kitalált személy ellen, vagy létező személy kitalált tettei ellen elég nehéz kortársként tiltakozni.
Aztán a halála után annyi mítosz épült rá a szájhagyományos terjesztés során, hogy már tiltakozni kellett.
Ez nem olyan bonyolult, mit nem értesz rajta?

"Az evangéliumok tele vannak olyan történetekkel, ahol Jézus hús-vér személyként jelenik meg."

Ja, más mesék meg hús-vér sárkányokkal, megint mások meg hús-vér Xenuval. És? Akkor ezek szerint ezek is éltek?

"A vita nem azon folyik, "

Nem érdekel túlságosan, hogy teológus körökben miről megy a vita. Ez nem az a közönség. Itt meg azon folyik.

"3. A holttest ellopásával való érvelés elég gyors érvelés kellett, hogy legyen, közvetlenül az események után."

Szerintem akár 300 év is lehetett. Az végülis elég gyors. Jelentősen el KELLETT terjednie a kereszténységnek, hogy a zsidók (mint "világ"vallás) egyáltalán fülük botját megmozdítsák. Akkoriban mindennaposak voltak az önjelölt próféták és messiások, ahhoz jelentős támogatottság kell, hogy egy nagy vallás egyáltalán bármit nyilatkozzon egy kis szektáról.

"Ha ez az érv, és nem az, hogy "Jézus csak egy mítosz", akkor az azt bizonyítja, hogy épp az ellenségek ismerték el: Jézus történelmi lény. Szó sincs "mítoszról". "

Na, akkor már értem mi a bajod. Súlyos fogalomzavarban szenvedsz.
Tehát ha van egy történelmi személy, akiről van egy sztori, amiben csodát tesz, vagy sárkányt öl, vagy akármi, akkor azt úgy hívjuk, hogy mítosz. A SZTORI a mítosz, nem a személy.

Ellenben itt különválasztandó a történelemtől. Lehet egy mitikus személy ALAPJA egy élő ember, de lehet teljes egészében kitalált is.
Az viszont lehetetlen, hogy a mitikus személy EGYBEESSEN a történelmivel.
Épp ezért az "ellopták a holttestet" a mítoszt szünteti meg, a sztorit hitelteleníti, és semmi köze a személyhez. Az már baromira nem érdekelte a zsidókat, hogy valójában létezett-e ilyen ember, meg egyébként mi értelme van kételkedni egy jelentéktelen ember létezésében? Jelentősége a feltámadásos sztori miatt volt, ha azt megszüntetik, a mitikus személyt is megszüntetik.

"Nyilván később írták le. Miért, mikor írhatták volna le? Előbb?"

KÖZBEN. Tudod, KORTÁRS beszámolók. Ne engem nézz hülyének, ha te nem gondolsz a nyilvánvaló megoldásra.
Egyébként meg nem, egyáltalán nem súlytalan az érv.
Teljesen mindegy, hogy 200 vagy 2000 évvel a halála után beszélgetünk arról, hogy élt-e. Már 200 évvel halála után sem eldönthető egyértelműen, hogy egyáltalán létezett-e ilyen nevű személy, feljegyzések hiányában. Feljegyzések márpedig nincsenek.

De lépjünk picit tovább:
Mi lesz, ha bebizonyítjuk, hogy valóban létezett egy Jézus nevű rabbi, aki még meg is fordult az említett helyeken, meg elindította a szektát, keresztre feszítették, és aztán a holttestét ellopták? Ezzel mitől vagyunk előrébb?

Bobby Newmark 2010.12.11. 16:44:02

@Mystes: "A szkepticizmus a(z abszolút) cél, ahová el akarunk érni/jutni, vagy inkább csak egy intellektuális attitűd (mert módszertannak azért nem mondanám), amivel azt akarjuk elérni, hogy ne higgyünk/fogadjunk el semmit/bármit, csak kritikával."

Utóbbi.

Egyébként azért, mert te bizonyos megalapozatlan állításokat elhiszel, amióta az eszedet tudod, az nem jelenti azt, hogy ezeket az állításokat vizsgálni értelmetlen, és ettől nem válik öncélúvá a szkepticizmus.

Az, hogy beléd gyerekkorodban belédneveltek egy dogmarendszert, és azóta is évtizedek óta kondícionálod rá magad, az még nem jelenti azt, hogy az érveid meggyőzőek.
Nem "semmilyen érv nem segít", hanem nincsenek érveid, csak feltételezéseid, amiket te már túl régen elfogadsz tényként.
Ez nyilván a te szemszögedből úgy tűnik, mintha rajtunk nem segítene semmilyen érv, de valójában az a helyzet, hogy te nem mondasz semmi meggyőzőt.

Mystes 2010.12.11. 16:44:59

@Mystes: Egy szkeptikus számára persze nincs (el)borzasztóbb kifejezés, mint az, hogy valami "csak hit". Az már semmiképpen nem lehet valóság, még kevésbé érvényes valóság. Eszébe sem jut, hogy a hittel (valamely hittel) a valósághoz való végső viszonyunkat fejezzük ki.

KenSentMe 2010.12.11. 17:10:14

@Mystes: Én nekem személy szerint semmi bajom nincs azzal, ha valaki hisz valamiben, nem borzaszt el - az ő koponyája, az ő feje, azt csinál bent, amit akar, ha gondolja, el is mondhatja, hogy ő igen mélyen hisz benne, engem ez nem kavar fel. Nekem az ilyenekkel van bajom:

"Olyasmit állítani, hogy Jézust valamiféle mondai/mítoszi elemekből "rakták össze", a szovjet típusú valláskritika tudott csak produkálni a legrosszabb időszakaiban."

Igen, pl. a Brian élete c. film is a szovjet valláskritika legsötétebb időszakait idézi (amiben, bár ugyan 2x feltűnik Jézus is, de az egész film végül is arról szól, hogy bárki átélhette volna abban a korban azt, amit Jézus, bárkiből lehetett volna vallásalapító megváltó), vagy pl. az újabb keletű Man of the Earth c. film is a legnagyobb sötétségről árulkodik, amiben a főszereplő maga kesereg azon, hogy Jézus történetéből talán két mondat, ha igaz, és maga se emlékszik rá, mit mondott a hegyi beszédben..

Minden ilyen felvetés egyfajta jeu d'esprit, vagy tour de force, és attól lesznek érdekes gondolati játékok, hogy túl sok minden nem bizonyítható Jézusról, tehát akár az is lehetséges, hogy ezek a gondolati játékok az igazak. És tényleg mindenki sötét szovjetista, akiben ez felmerül?

"Ha egy MAI zsidót/ellenzőt, mohamedánt kérdeznénk meg, az sem azzal vitatkozna, hogy Jézus élt-e. Tehát nem érv az, hogy az akkoriak azt sem tudták, mit beszélnek. A maiak sem tudják?"

Abból, hogy egy átlagos színvonalú ember (vallásos, nemvallásos, zsidó - ez most legyen lényegtelen) érvelő manapság mit vitatna, és abból mi következik implicite, az szerinted elég nyomós érv arra, hogy egy személy létezett-e?

Tegyük fel, hogy Aladár és Béla játszanak. Aladár: Béla, tudják rólad otthon, hogy hülye vagy?
Béla: (Feldühödik, nem tud gondolkodni) Nem, dehogy! (Hiszen tényleg nem tudják.. hogy is tudhatnák, hiszen nem hülye.)
Aladár: Hahaha.. ha nem tudják, akkor nyilván hülye vagy, hiszen ha nem volnál hülye, maga a kérdésem volna értelmetlen. Mivel nemet mondtál, implicit beismerted, hogy hülye vagy!

Én személy szerint nem hiszek benne, hogy ezzel az implicit kérdezgetős játékkal bármi kideríthető, ugyanis az ember általában képtelen végiggondolni az állítása összes következményét. (És adott esetben belegondolni abba, hogy ha maga személy szerint úgy is hiszi, hogy Jézus nem létezett, akkor azzal a kijelentésével, hogy nem támadott fel, mégis a létezése mellett foglal állást implicite.)

Mystes 2010.12.11. 17:30:10

@Bobby Newmark:

1., "Ha a feltámadásos mese nincs, akkor egy utolsó jelentéktelen kis zsidó rabbicska marad, mint az összes többi, akiknek ma nem tudod a nevét és akikről nem is tudsz."
Ez így van.

2., "A kortársak nem tiltakoztak, mert nem volt mi ellen. Kitalált személy ellen, vagy létező személy kitalált tettei ellen elég nehéz kortársként tiltakozni."
A) Az, hogy kitalált személy-e, még "nem döntöttük el". Keressük a kritériumokat.
B) Ha meg, később, a feltámadásról beszélsz, az nem 'kitalált tett', hanem esemény. Aminek híre ellen AZONNAL tiltakozni kellett. Ez ugyanis durván sértette nemcsak a vallásos zsidók, hanem a rómaiak érdekeit is! Gondolj bele: Nagy Imrét kivégzik. Erre rá pár napra elterjed a hír, hogy mégis látták élve. Hát nem az-e a (Kádár) hatalom elsőrendű és azonnali érdeke, hogy ezt cáfolja? Az ilyen híreket, evidens módon, a holttest prezentálásával szokták cáfolni.

3., "Tehát ha van egy történelmi személy, akiről van egy sztori, amiben csodát tesz, vagy sárkányt öl, vagy akármi, akkor azt úgy hívjuk, hogy mítosz. A SZTORI a mítosz, nem a személy."
Ezzel akár még egyet is lehet érteni. Hiszen akkor végre eljutottunk oda, amit magam is mondok: Jézus személy!

4., "Az "ellopták a holttestet" a mítoszt szünteti meg, a sztorit hitelteleníti, és semmi köze a személyhez. "
Ez így van. A személy meglétét nem érinti. Azzal a kiegészítéssel, hogy nem hitelteleníti. Ők ezt állították. Szemben azzal, amit mások állítottak.

5., "...hogy egyáltalán létezett-e ilyen nevű személy, feljegyzések hiányában. Feljegyzések márpedig nincsenek."
Milyen "feljegyzések" lennének számodra meggyőzőek? Mondjuk egy ilyen feljegyzés: "Jézus márpedig élt." ?

6., "De lépjünk picit tovább:
Mi lesz, ha bebizonyítjuk, hogy valóban létezett egy Jézus nevű rabbi, aki még meg is fordult az említett helyeken, meg elindította a szektát, keresztre feszítették, és aztán a holttestét ellopták? Ezzel mitől vagyunk előrébb?"
Például annyival, hogy azt, hogy "a holttestét ellopták" valakik állítják. Mások mást állítanak. Milyen alapon döntsük hát kettőjük állítása között? Ez ugyanis szintén vagy-vagy kérdés. Nem lehet mind a kettő :)

Mystes 2010.12.11. 17:53:33

@VRbagoly:

1., A szovjet valláskritikára tett megjegyzésemet fenntartom, ugyanakkor készséggel elismerem, hogy a jelen vitában/beszélgetésben nem lehet érv.

2. "Abból, hogy egy átlagos színvonalú ember (vallásos, nemvallásos, zsidó - ez most legyen lényegtelen) érvelő manapság mit vitatna, és abból mi következik implicite, az szerinted elég nyomós érv arra, hogy egy személy létezett-e?"
Nem. Éppen ezért kell arra hagyatkoznunk, amit az akkoriak mondtak. (Annál is inkább, mert amit a maiak mondanak, az is leginkább azokra hagyatkozik.)

3. "Én személy szerint nem hiszek benne, hogy ezzel az implicit kérdezgetős játékkal bármi kideríthető, ugyanis az ember általában képtelen végiggondolni az állítása összes következményét. (És adott esetben belegondolni abba, hogy ha maga személy szerint úgy is hiszi, hogy Jézus nem létezett, akkor azzal a kijelentésével, hogy nem támadott fel, mégis a létezése mellett foglal állást implicite.)"
Ez nem így van. Ha valakinek meghalt az anyja, és találkozik a barátjával, aki még ezt nem tudja, és az megkérdezi tőle, hogy "ugye beteg az édesanyád?", akkor arra nem az lesz a válasz, hogy igen, beteg, hanem az hogy meghalt.

Mystes 2010.12.11. 17:58:44

@VRbagoly:
3. "Én személy szerint nem hiszek benne, hogy ezzel az implicit kérdezgetős játékkal bármi kideríthető, ugyanis az ember általában képtelen végiggondolni az állítása összes következményét. (És adott esetben belegondolni abba, hogy ha maga személy szerint úgy is hiszi, hogy Jézus nem létezett, akkor azzal a kijelentésével, hogy nem támadott fel, mégis a létezése mellett foglal állást implicite.)"

1., Akik hisznek/állítanak valamit, azoknak ugye nem hiszünk, mert ugyan miért is hinnénk, nem igaz? Biztos elfogultak!
2., Tehát akkor azok állítását kell megvizsgálnunk, akik nem hisznek az előbbieknek, és abból kell kihámoznunk, ami (implicite) benne van.

Mi egyéb (ennél szkeptikusabb) módszert tudnál még ajánlani?

KenSentMe 2010.12.11. 18:01:00

@Mystes: Viszont azt mondhatná, hogy "nem, már nem beteg", és tarthatna utána egy hosszabb csöndet.

"Ha meg, később, a feltámadásról beszélsz, az nem 'kitalált tett', hanem esemény. Aminek híre ellen AZONNAL tiltakozni kellett. Ez ugyanis durván sértette nemcsak a vallásos zsidók, hanem a rómaiak érdekeit is! Gondolj bele: Nagy Imrét kivégzik. Erre rá pár napra elterjed a hír, hogy mégis látták élve."

Jól értem, hogy a te logikád szerint azonnal tiltakoztak Jézus kivégzése után a feltámadása ellen a kortársak? És ennek hol vannak a nyomai?

Ha pedig nem tiltakoztak, az tényleg azt bizonyítaná, hogy elismerték a feltámadást? Nem azt, hogy míg Nagy Imre egy jelentős személyiség volt az 50-es években, addig Jézus annyira jelentéktelen volt a maga korában, hogy nem érdekelte a kivégzőit, hogy élő vagy halott-e?

Mystes 2010.12.11. 18:26:43

@VRbagoly:

1., "Jól értem, hogy a te logikád szerint azonnal tiltakoztak Jézus kivégzése után a feltámadása ellen a kortársak?"
Igen. Jól érted. Azzal a kis kiegészítéssel, hogy nem a feltámadása ellen tiltakoztak, hanem a feltámadásáról szóló hírek ellen. A feltámadása ellen hiába is tiltakoztak volna... :)

2., "És ennek hol vannak a nyomai?"
A zsidók közt híre terjedt, hogy a holttestet ellopták. De, ha ez nem is lenne leírva az evangéliumokban, akkor is, ugyan mire gondolhatnánk? Vajon mivel magyarázták volna (meg) a római hatóságok és a zsidó hatóságok a (holt)test hiányát? Valamit csak mondaniuk kellett!

3., "Ha pedig nem tiltakoztak, az tényleg azt bizonyítaná, hogy elismerték a feltámadást? Nem azt, hogy míg Nagy Imre egy jelentős személyiség volt az 50-es években, addig Jézus annyira jelentéktelen volt a maga korában, hogy nem érdekelte a kivégzőit, hogy élő vagy halott-e?"
Jelentéktelen? Azért azt nem mondanám! Tudjuk, hogy Jézus, halála előtt közvetlenül, feldúlta a jeruzsálemi Templomot, szentséggyalázást követett el! Olyan ez, mintha valaki ma bemenne a budapesti Bazilikába és mise közben végigszarná az oltárt. Nehogymár azt akarjuk itt elhitetni, hogy "nem figyeltek fel rá". Nagyon is felfigyeltek!

KenSentMe 2010.12.11. 18:46:15

@Mystes: "Tudjuk, hogy Jézus, halála előtt közvetlenül, feldúlta a jeruzsálemi Templomot, szentséggyalázást követett el!"

Nonono. Ezt honnan tudjuk? Az evangéliumokból? Ez a .."Jézus kiűzi a kalmárokat a templomból" epizód?

"Nehogymár azt akarjuk itt elhitetni, hogy "nem figyeltek fel rá". Nagyon is felfigyeltek!"

Én nem akarok elhitetni semmit, és örülök neki, hogy olyan biztos vagy benne, hogy felfigyeltek, én csak kérdeztem. De akkor is áll a kérdésem.. honnan tudjuk, hogy felfigyeltek rá? Az evangéliumokból?

Mert ha végsősoron minden okoskodásod onnan indul ki, hogy az evangéliumok ezt vagy azt írták, akkor mit szóljanak azok, akik szerint az evangéliumok csupán a mítoszok szintjén mozognak?

Mystes 2010.12.11. 19:04:51

@VRbagoly:

1., "Ezt honnan tudjuk? Az evangéliumokból? Ez a .."Jézus kiűzi a kalmárokat a templomból" epizód?"
Igen.

2., "Mert ha végsősoron minden okoskodásod onnan indul ki, hogy az evangéliumok ezt vagy azt írták, akkor mit szóljanak azok, akik szerint az evangéliumok csupán a mítoszok szintjén mozognak?"
Azok is szóljanak valamit! Nem elég csak annyit "szólni", hogy "mítosz", aztán slussz-passz. Mitológiatudomány talán nincsen? Azután: szívesen kiindulok én bármiből, nemcsak az evangéliumokból. De nem épp Ti mondjátok, hogy régészeti és egyéb forrásoknak eléggé híjával vagyunk? Akkor miből induljak ki másból?

3., Arra vonatkozóan semmi forrásunk nincsen, hogy a rómaiak, a végrehajtó hatalom mit szólt a hírekhez. Pedig valamit szólniuk kellett! Azért azt a blamázst mégsem hagyhatták, hogy ők kivégeztek valakit, mert zavargott, aztán pár nap múlva jön egy zavargó szekta, ami megint csak veszélyezteti az ő politikai hatalmukat! Őket ugyan a Templom feldúlása nem érdekelte, de ez utóbbi annál inkább!

Tom Benko 2010.12.11. 19:04:56

Nem tudom, mennyiben kapcsolódik még a Jézus életéről szóló vita ehhez a topikhoz, de engem speciel nem kicsit untat.

Mystes 2010.12.11. 19:17:17

@VRbagoly:
Mit jelent egyébként az, hogy "mítosz"? Félek tőle, hogy a mítoszt kitárólag egy vulgármarxista szemszögéből nézitek. A mítosz: világértelmezés. Még akkor is így van ez, ha a jelenkori, modern történettudomány szerint nem történelem. És, akkor mi van? Csak a történelem lenne "valóság"? Ezt maguk a történészek sem mondják.

Mint ahogy Ti is mondtátok,nemcsak maga a mítosz történelmi valóság, hanem annak vannak történettudományos módszerekkel igazolható, történeti alapjai is. Schliemann kiásta Tróját. Jelenti ez azt, hogy Homérosz műve "szóról szóra" úgy igaz, ahogy, ahogy a költő megverselte? Nyilván nem. De azt jelenti, hogy volt egyszer egy x háború, ami alapját képezte a költeménynek.

Miért nem lehet megérteni, hogy hasonló igényességgel kell vizsgálni az Evangéliumokat is? Miért kell hozzá dogmatikusan viszonyulni? Akkor mivel vagytok különbek az általatok kritizáltaknál?

Mystes 2010.12.11. 19:22:07

@Tom Benko: Annyiban kapcsolódik ide, hogy tisztázódhatna: a Teremtés (mint fogalom) egy hitkijelentés. Ezen túl aztán, akárhogy megvalósulhat/ott. Minden kornak megvan az elképzelése, hogy ez hogyan történt. A maiaknak is, meg a kétezer évvel ezelőttieknek is, meg az indiaiaknak is, stb. Ezek a módusok azonban nem változtatnak magán az ontológiai kijelentésen. Ezt nem értik sem az ID-hívek, sem azok az evolucionisták, akik a biológiából hitkijelentést csinálnak, átlépve ezzel illetékességi körüket, átkalandozván az ontológiai kijelentések mezejére.

Tom Benko 2010.12.11. 19:32:08

Akkor érdektelen.
Biológiából ki csinált hitkijelentést?

Mystes 2010.12.11. 19:37:53

@Tom Benko: A biológiából azok csinálnak hitkijelentést, akik szerint az evolúcióból bármiféle ontológiai kijelentés következik, illetve levonható. Valljuk be, nagy kísértés ez. Dawkins is ebbe a hibába esik.

pounderstibbons 2010.12.11. 19:46:18

@Mystes:
Ha lett volna a trójai háborúról másik irodalmi mű, akkor a leletek alapján el lehetne dönteni melyiknek volt inkább igaza.

Vallásos irodalmon alapuló teremtésmítoszok esetén viszont ez aligha lehetséges, ahol viszont vizsgálhatók a vallásos művek által szolgáltatott adatok, ott nem az tűnik ki, hogy bármit is eltaláltak volna, amit a keletkezésük korában élő tudósok nem tudtak.

Vagy te ismersz ilyet a Bibliából pl.?

vorosgy 2010.12.11. 19:49:23

@Mystes: Azért írtam, hogy "feltételezett halála". :)

Tényleg Márk volt az első, elrontottam, csak az Újszövetségben meg Máté evangéliuma az első könyv, és mindig összekeverem őket. :)

Mystes 2010.12.11. 19:59:54

@pounderstibbons:
A bibliai korban nem volt a mai értelemben vett "tudomány". Abban a korban azt írták le ezekben a könyvekben a világról, amit akkor gondoltak. Nem volt egy "párhuzamos" tudomány, ami másképp gondolkodott volna. Ennek nagyon visszavetítés-szaga van. De, az is csak módjával. A mai teológiatudomány teljesen szinkronban van az összes többi, más, "civil" tudománnyal. Csak kevésbé ismerik, főleg ha nem érdeklődnek iránta...

Mystes 2010.12.11. 20:05:28

@vorosgy:
"Feltételezett halál", nem feltételezett halál, mindegy. Halál. Márpedig meghalni csak az tud, aki élt :)

KenSentMe 2010.12.11. 20:45:05

@Mystes: Írhatnék újra hosszan, de Bobby Newmark egyik érvét szeretném megismételni (átfogalmazva)..

ha pl. Jézust tényleg utólag alkották meg, és valójában három személyről szóló mondákat gyúrtak egybe (egy, aki tanított, egy, aki gyógyított, egy, aki feltámadt - három különc, ismeretlen ember, aki csak kései tanítványok emlékezetében kapcsolódott össze), akkor

- örülsz annak, hogy Jézus létezett, sőt, háromszorosan létezett

- szomorú vagy, hogy a Bibliai történet 95%-a irodalom, és ennek a három jóembernek még a nevét sem sikerült hitelesen megőrizni az utókor számára (sőt, azt sem, hogy hányan volt:))?

Bobby Newmark úgy érvelt (kb.), hogy Jézus akkor létezett, ha úgy létezett, hogy fel is támadt, és tényleg Isten fia volt. Egyesek már azt is elfogadná létezésnek, ha mondjuk egy Jerobeám nevű úriember köré alakultak volna ki ezek a mítoszok, mások pedig nem fogadnák el, mondván, hogy milyen röhejes, ha valakit úgy hiszünk ismertnek, hogy még a nevét sem tudjuk, hozzávetőlegesen sem. Van, aki már akkor elfogadná létezőnek, ha bármi valóságalapja volna a történetének.. tehát annak is örülne, ha tényleg három Jézus létezett volna. (Ahogy pl. Homéroszból is kettő volt.)

Úgy is mondhatnám - a létezésnek és a nemlétezésnek is vannak fokozatai a mitológiában, és amikor azt mondod, hogy létezett!, akkor akaratlanul is úgy érezhetik egyesek, hogy ezzel az evangéliumok igazságát hirdeted.

Mystes 2010.12.11. 21:02:08

@VRbagoly:

1., "Örülsz annak, hogy Jézus létezett, sőt, háromszorosan létezett"
Nem, nem örülök.

2., "szomorú vagy, hogy a Bibliai történet 95%-a irodalom, és ennek a három jóembernek még a nevét sem sikerült hitelesen megőrizni az utókor számára (sőt, azt sem, hogy hányan volt:))?
Nem, nem vagyok szomorú.

Én egy robot vagyok!

3., "Amikor azt mondod, hogy létezett!, akkor akaratlanul is úgy érezhetik egyesek, hogy ezzel az evangéliumok igazságát hirdeted."
Úgy érzik? Hát tehetek én arról?

PS:
Egyébiránt, persze bolondság. Az evangéliumok mondanivalója nem az, hogy Jézus létezett. De, persze ez előfeltétel, az igaz.

vorosgy 2010.12.11. 21:26:32

@Mystes: Aki nem élt, arról is feltételezhetik, hogy élt, és meghalt. Nem értem, mi a problémád ezzel.

Ziprian 2010.12.11. 21:44:32

Egy szkeptikus nem dőlhet be a "klasszikus" vagy-vagy trükknek :)

Vagyis simán lehet az is, hogy se az ID-nek se a másik oldalnak nincs igaza. Legalábbis ezt is számításba kéne venni. Legalábbis szerintem. :)

(lehet, hogy már volt korábban is, sorry, de nem láttam )

Mystes 2010.12.11. 22:01:36

@Ziprian:
Mindkettőnek igaza van valamiben, és nincs igaza valami másban.

1., Az evolúció történelem. De nem alkalmas az evolúció ontológiai kijelentések megtételére. Itt az evolúcióbiológusok hibáznak.
2., Ez a hiba előhívja az ID-t, ami meg az evolúciót (illetve annak tagadását) ontológiai kijelentésekkel keveri.

Talán ez utóbbi még közelebb is áll "az igazsághoz", hiszen az evolúció, mint a teremtés technológiai és történelmimegvalósulása, _egyszerre_ kell, hogy működjön az ontológiával. Mégis hibájuk, hogy tévesen, az evolúció technikáját, vagy magát az evolúciót bírálják, ontológiai előfeltevéseikből kiindulva.

Mystes 2010.12.11. 22:02:49

@vorosgy:
"Aki nem élt, arról is feltételezhetik, hogy élt, és meghalt."
Ez, elviekben, így van. Jelen esetben azonban nem erről van szó :)

Ziprian 2010.12.11. 22:40:23

@Mystes: sajnálom, hogy a "viccemet" ilyen belemagyarázásra használod.

Egyrészt szerintem az evolúció nem történelem, hanem egy elmélet. Másrészt, az evolúció nem is akar foglalkozni az ontológiával. (szemben egy vallásos teremtéstörténettel)

Ezenkívül, (az eredeti üzenetem inkább ezt sugallja) azért mert van egy elméleted, ami sok ponton alátámasztható de egyelőre vannak még kérdések vele kapcsolatban, nem jelenti automatikusan azt, hogy a másik elmélet az igaz. Erről is szól a "vagy-vagy" cucc.

pounderstibbons 2010.12.11. 22:55:23

@Mystes:
"1., Az evolúció történelem. De nem alkalmas az evolúció ontológiai kijelentések megtételére. Itt az evolúcióbiológusok hibáznak.
2., Ez a hiba előhívja az ID-t, ami meg az evolúciót (illetve annak tagadását) ontológiai kijelentésekkel keveri."

Akár igazad is lehetne, ha az ID története úgy kezdődött volna, hogy Richard Dawkins elkezdi követelni, hogy az evolúciót tanítsák a gyerekeknek hittanórán, és erre válaszul összefognak a vallásos szemléletű személyek, hogy ezt megakadályozzák

Valahogy mégsem ez történt.

ghavin 2010.12.11. 22:59:45

"1. nem egyenlőségjelet tettem, hanem egy másik tudományterületről hoztam példát, illusztrálni. Azt, hogy közvetett bizonyítékok alapján is ki lehet mondani, valaki létezett-e, vagy sem."

Akkor pedig az optikai vizsgálattal ellenőrizhető közvetlen bizonyíték és az emberi "szubjektív szűrőn" áthaladó közvetett információ közé tettél illusztris egyenlőségjelet. pedig teljesen más a közvetettség természete.

"2. miért hagynám figyelmen kívül? Éppen te nem veszed észre, hogy a függetlenítés kb. a marginális koncepciók esetében működik. A világtörténelmet meghatározó személyek rendszerint léteztek, maximum nem úgy, ahogy a hívek/utókor lefesti. Lásd: Buddha, vagy Lao-ce."

Az eljövendő messiás a tőle elválaszthatatlan jóslat természetéből adódóan eléggé marginális koncepció.

"Éppen a számos messiás erősíti azt, hogy simán élhetett Jézus is. Ha csak ő mondta volna magáról, hogy messiás, akkor gyanakodhatnánk."

És legalább ennyi mesterségesen konstruált messiás is képviseltette magát a mediterráneum misztérium-dömpingjeiben. Éppen ezért hoztam be az érvelésembe az ún. manifesztációs kultuszokat, ahol az aktuális főpap(ok)/főpapnő(k) minden esetben az isteni esetleges megnyilvánulása volt. Az ilyen kultuszok kutatásánál gyakorlatilag nem lehet eldönteni, hogy az "egyházi" struktúrában az egyes "címek" valódi hierarchikus pozíciót vagy egyfajta spirituális lépcsőfokot jelentettek a hitállapotok ranglétráján.

"Az isteni manifesztációnak akkor is kellett hordozója legyen. Vagy szerinted nem léteztek az egyiptomi fáraók, csak mert Hórusz manifesztálódott bennük az egyiptomiak hite szerint?"

Rossz példa, ugyanis a fáraó titulus nemcsak isteni állapotjelző, hanem örökletes cím is volt, emellett a fáraóknak volt önálló neve. A Jézus Krisztus esetében abban sem lehetünk biztosak, hogy ha létezett is az evangéliumok által leírt személy, akkor valóban Jézus Krisztusnak hívták. Simán benne van a pakliban, hogy utólag ragasztották rá ezt a "címet", annak érdekében, hogy bele illeszkedjen az előzetes próféciába és az utólag összeeszkábált vallás rendszerébe. Jézus = megváltó úr, Krisztus = a felkent.

"ÉS?! Mi itt a történelmi Jézusról vitázunk, nem a vallás Jézusáról!"

Én is. Csupán arra próbáltam utalni, hogy ha az adott vallás központjában álló személy esetenként egy hús-vér emberként (manifesztáció) is "létezik", maga az imádott személy még akkor is csupán transzcendens koncepcióként van jelen, ami kizárólag a hívők előtt létezik az aktualitásban. A név, a tettek, a tanítás is.

"Azt hittem, világos, hogy a történelmi személy az történelmi személyt jelent és nem vallási-mitikus személyt :D"

Oké, ha nem esett volna le a tantusz, az előző hozzászólásomban is azt a gondolatot próbáltam a világra segíteni vajúdó agyadban, hogy a "Jézus korának" nevezett időszak ismeretei alapján nyugodt szívvel kijelenthetjük: Jézus Krisztus már a saját korában is lehetett teljesen kitalált személy (nem csak a nevében, tetteiben és tanításában, hanem a tényleges létezését illetően is) úgy, hogy az alakja körüli kultusz is fennmaradhasson. Ha mindez nem lenne elég, e lehetőségnek a rendelkezésünkre álló források alapján ugyanakkora az esélye, mint annak, hogy a bibliai, valóban isten/istenfia Jézus isteni varázslataival valóban csodákat művelt. Bár a történelmi és kulturális kontextus nyilván más, ugyanez áll Buddhára és Lao-Cere is: abban sem lehetünk biztosak, hogy személyük eredendő koncepciója valóban a koncepcióval azonosítható személytől ("maguktól") vagy csupán az azt kitalálók fantáziájából származik. Az nem érv, hogy ilyen történelmi hatás mögött feltétlenül állnia kellett valakinek a maga egzaktságában.

Mystes 2010.12.11. 23:00:12

@Ziprian:

1., "Egyrészt szerintem az evolúció nem történelem, hanem egy elmélet."
Egy olyan elmélet, aminek vannak időbeli aspektusai.

2., "Az evolúció nem is akar foglalkozni az ontológiával."
Jó lenne, ha így lenne. Dawkins erre nem jó példa. Az evolúcióból kiindulva állandóan ontológiával foglalkozik.

3., (szemben egy vallásos teremtéstörténettel)
Abban még együtt van a történelmi szemlélet az ontológiával. Ma már ez kettévált.

4., "Van egy elméleted, ami sok ponton alátámasztható de egyelőre vannak még kérdések vele kapcsolatban"
Mik ezek?

5., "Nem jelenti automatikusan azt, hogy a másik elmélet az igaz. Erről is szól a "vagy-vagy" cucc."
Ez így igaz. Mohamednek ettől még nincs igaza :)

Mystes 2010.12.11. 23:16:41

Azt azért megkérdezném Ghavintól, hogy szerinte mekkora valószínűsége van egy olyan kultusznak, ami olyasmit állít, amivel nemigen szerezhet híveket magának? Tekintettel arra, hogy minden kultusz célja, hogy híveket nyerjen.

Ziprian 2010.12.11. 23:31:00

@Mystes: más az időbeli aspektus és más a történelem, de asszem ez most nem fontos, nem is ez volt az első válaszod lényege.

Szerintem keresztény ember is lehet evolúcióhívő annak ellenére hogy egy-egy evolúcionista ebből ontológiai kérdést csinál.

"4., "Van egy elméleted, ami sok ponton alátámasztható de egyelőre vannak még kérdések vele kapcsolatban"
Mik ezek?"

Itt nem a Te elméleteidre, gondolataidra utaltam, félrevezető lehetett a ragozás.

Arra gondoltam, hogy csak azért, mert a zsiráf egy furcsa állat és mert vannak az evolúció elméletben kérdőjelek, nem jelenti azt, hogy az ID az igaz.

Ezt csak azért emeltem ki, mert egy ideje ez az érvelés egyre trendibb, és sokan felülnek rá :)

Mystes 2010.12.11. 23:38:17

@Ziprian:

1., "Szerintem keresztény ember is lehet evolúcióhívől."
Az evolúcióban nem hinni kell, az egy elmélet. Nem ontológia. De persze értem, hogy mit akarsz mondani :)

"4., "Mert a zsiráf egy furcsa állat és mert vannak az evolúció elméletben kérdőjelek, nem jelenti azt, hogy az ID az igaz."
Az ID baja az, hogy ontológiai alapon támadja az evolúciót. Szerintem, mint ahogy mondtam is, ez mintegy öntudatlan reakció egyes evolúcióbiológusok
ontológiai túlkapásaira.

maycontainnuts 2010.12.11. 23:58:47

@Mystes:
Ontológiai alapon támadna az ID, akkor rossz ajtón kopogtat.
Filozófiai alapon szerintem nem támadható egy természettudomány se.
Az ID se azt állítja, hogy filozófiai problémája van az evolúcióval, hanem hogy bizonyítékai vannak rá, hogy tud nála jobb magyarázatot.

Mondjuk ezeket a bizonyítékokat eléggé titkolja, de ezt állítja.

Van is erről néhány cikk meg egy egész vita valahol. :)

Meg lehet próbálni beállítani az ID-t mint ellencsapást, a naturalizmus/materializmus/evolúcióbiológusok túlkapásaira, de akkor be kéne mutatni ezeket a túlkapásokat, amivel kiléptek a biológiaóráról a filozófia területére.

Vagy te hallottál olyat, hogy biológusok akarták átírni a filozófia/hittan tananyagot?

Opett 2010.12.11. 23:59:21

@Mystes: Sokszor leírtad azt, hogy a zsidók azt állították, hogy a keresztények ellopták a testet. Forrást tudnál erre adni? Csak nem az Újszövetség? Mert az bizony nem jó... Bibliával bizonyítani a Bibliát...

Egyáltalán, kit nevezel Jézusnak, amikor azt kérdezed, történelmi személy-e? Jézus, a rabbi? Vagy Jézus, az isteni reinkarnáció? Vagy Jézus, a bölcs jeruzsálemi fűszeres?
Simán elfogadom, élt egy rabbi, akiről az evangélium Jézus karakterét mintázták.

Azonban a valódi Jézus életéről semmit sem tudunk, az Evangéliumok jóval halála után íródtak, nem tudni kik által, és ellentmondanak egymásnak. Pál levelei relatíve koraiak, de keveset mondanak Jézus életéről. A gnosztikusok, az apokrif iratok, az ókeresztények sok változata mind más-más képet fest róla. Az ókereszténység koránt sem volt annyira egységes, mint azt ma a hittanórákon tanítják. Az iratok, amik fennmaradtak, nem eredetiek, csupán másolatok másolatainak másolata, amibe sokszor beleírtak, átírtak, a másolási hibákról ne is beszéljünk.
A Jézust körülvevő csend is gyanús. Egyetlen történelmi forrás sem említi életének egyetlen fontos eseményét. Szerinted egy történetíró sem jegyezné le, ha egész birodalomban népszámlálást kellene tartani? Vagy ha a király úgy dönt, hogy minden csecsemőt meg kell gyilkolni? Vagy hogy zsidó zombik ezrei lepik el Jeruzsálemet?

De tudod mit, leszek az isten ügyvédje. Mindezektől eltekintve, a játék kedvéért tegyük fel, hogy vannak szemtanúink, akik beszámolnának az evangélium csodáiról? Hihetőbbé válik-e az egész?
- Egy cseppet sem. Ma is vannak olyan emberek, akik jóformán az összes evangéliumi csodát végrehajtják (legalábbis elhitetik emberekkel). Én szélhámosoknak hívom őket, a hiszékenyek meg isteni reinkarnációnak. Pl. ott van Sai Baba indiai guru. Hívek ezrei állítják, hogy vizen jár, hogy halottat támasztott fel, hogy az anyja szűz volt, hogy teremt anyagot, stb. Keress rá youtubon, és készülj fel a csalódásra, ócska, huszadrangú bűvésztrükkökre.
Gondolj bele, ha a 21. században emberek millióit be tud csapni egy ilyen szélhámos, mennyivel könnyebb volt embereket becsapni az ókori jeruzsálemben, amikor a babona és az írástudatlanság uralkodott, amikor azt hitték, a betegségeket démonok okozzák, s hogy a Föld lapos és kicsi.

Nyugodtan higgy, ha neked jólesik, de ne próbáld meg úgy beállítani, hogy mennyire racionális, mert egyszerűen nem az.

Ziprian 2010.12.12. 00:00:23

1: akkor ezzel be is fejezhetjük egymás(!) "kóstolgatását" :)

most, hogy kicsit visszaolvastam a kommentekben, kicsit meglepődtem, hogy ez a téma ennyire a vallás körül kering. Végülis ez érthető, és az is kerek, amit írsz.

Személy szerint úgy tekintek az evolúcióra, mint egy biológiai elméletre. A hitre meg inkább mint egy szociológiai kérdéskörre. Ezért is lepett meg elsőre, hogy ez a (számomra) két dolog keveredik.

Volt egy osztálytársam (egyházi iskola volt), aki fizikaórán, amikor a világ keletkezéséről tanultunk, azt mondta, hogy ő ebben nem hisz, mert a bibliában más van írva.
Mire leéretségiztünk már azt mondta, hogy a tudomány Isten művének magyarázata, de boldog volt, hogy az ősrobbanás első 1E-40 másodpercére nincs jó magyarázat (ez 2006 előtt volt). Ebben az időszeletben kapaszkodott.

Lehet, hogy néhány ID hívőben is hasonló játszódik le. Pedig a kettő dolgonak valójában nem sok köze van egymáshoz.

Ziprian 2010.12.12. 00:02:34

2006-ot csak azért mondtam, mert fogalmam sincs a fizikáról azóta :)

Mystes 2010.12.12. 00:08:53

@maycontainnuts:
Nagyon erős a kísértés arra, hogy a természettudományok képviselői odáig jussanak el, hogy a módszertanukból/elméleteikből világnézetet csináljanak... Már csak azért is így van ez, mert a módszertan senkit nem érdekel. Ellenben az ontológia igen :)

ghavin 2010.12.12. 00:13:26

@Mystes: Ez nem kérdés, hanem kérdésbe burkolt kijelentés volt, vagyis hogy a keresztény kultusz önmagában nem lett volna képes híveket szerezni. Vagy akkor javíts ki ha tévednék, s hagyj fel azzal a kibaszott idegesítő szokásoddal, hogy ilyen, két lépéssel már egy újabb mellékvágányra tartozó belekérdezéssel manipulálsz, ahelyett, hogy az érdemi érvekre reagálnál.

Mystes 2010.12.12. 00:13:38

@Ziprian:
Az ontológiai kijelentések irreductibilisek. Ahogy mondod, (tipikusan) rossz magatartás, amikor Istent a még nem ismertbe helyezzük.

ghavin 2010.12.12. 00:21:33

@Mystes: Mi köze van az ontológiának a világnézethez? Miért ne lehetne tudományos alapra helyezni egy világnézetet? Hagyd már abba az állandó mellébeszélést, állj elő azzal a kibaszott farbával, s mond el, hogy tulajdonképpen mi is bassza a csőrödet, s végre lezárhatnánk ezt az általad generált, a poszt szempontjából tökéletesen irreleváns vitát.

Ziprian 2010.12.12. 00:33:25

@Ghavin:szerintem nincs is farba. ráadásul mivel az ontológia filozófiai elmélet az evolúció meg biológiai, sosem lehet lezárni egy ilyen vitát :)))

@Mystes: egyébként miért mondod, h irreducibilis az ontológia?

Mystes 2010.12.12. 00:35:25

@Opett:
1., "Sokszor leírtad azt, hogy a zsidók azt állították, hogy a keresztények ellopták a testet. Forrást tudnál erre adni? Csak nem az Újszövetség? Mert az bizony nem jó... Bibliával bizonyítani a Bibliát..."
Nem, én nem a Bibliával szeretnék bizonyítani, bár megtehetném. Veled szeretnék bizonyítani. TE mit mondasz, most/ma, hogy mi lett a testtel?

2., "Simán elfogadom, élt egy rabbi, akiről az evangélium Jézus karakterét mintázták."
Tulajdonképpen idáig akartunk eljutni! :)

3., "az Evangéliumok jóval halála után íródtak"
Tehát akkor mégiscsak élt. Megnyugtató :)

4., "A Jézust körülvevő csend is gyanús. Egyetlen történelmi forrás sem említi életének egyetlen fontos eseményét."
A Bibliai könyvek ugyanolyan történelmi forrás, mint bármi más. Nem történelem, hanem történelmi forrás. Ki kell értékelni a történettudomány módszerei szerint!

5., "Nyugodtan higgy, ha neked jólesik, de ne próbáld meg úgy beállítani, hogy mennyire racionális, mert egyszerűen nem az."
Én sehol nem mondtam, hogy a hit racionális. Mint ahogy azt sem, hogy irracionális. A hit az hit. Megvannak a maga saját jellemzői és tulajdonságai.

maycontainnuts 2010.12.12. 00:36:19

@Mystes:
Akkor most az ID arra jött létre válaszul, hogy a biológusok meg lettek kísértve?

Peter T. Sinclare 2010.12.12. 00:37:00

@Ghavin: "Akkor pedig az optikai vizsgálattal ellenőrizhető közvetlen bizonyíték és az emberi "szubjektív szűrőn" áthaladó közvetett információ közé tettél illusztris egyenlőségjelet. pedig teljesen más a közvetettség természete."

OMG. A lényeg a közvetettség. Az, hogy közvetett bizonyítékok alapján következtetünk arra, hogy van/volt ott valami, ami hatással van/volt a környezetére. Mit kell ezen túlragozni?

"Az eljövendő messiás a tőle elválaszthatatlan jóslat természetéből adódóan eléggé marginális koncepció."

Valóban az volna? Ez a "marginális koncepció" határozta meg az elmúlt 2000 év nyugati, és 500 év globális történelmét, beleértve a természettudományok kialakulását, az evolúció elméletének megalkotását, vagy a kapitalizmus, liberalizmus és kommunizmus kialakulását. Tényleg marginális... ;)

"És legalább ennyi mesterségesen konstruált messiás is képviseltette magát a mediterráneum misztérium-dömpingjeiben."

Na, mondj két példát. Még a zoroasztrizmus eljövendő messiása is Zarathusztra kései reinkarnációja - Z. is ilyen reinkarnáció volt.

A messiásjelöltek jellemzően élő személyek voltak.

"Éppen ezért hoztam be az érvelésembe az ún. manifesztációs kultuszokat, ahol az aktuális főpap(ok)/főpapnő(k) minden esetben az isteni esetleges megnyilvánulása volt. Az ilyen kultuszok kutatásánál gyakorlatilag nem lehet eldönteni, hogy az "egyházi" struktúrában az egyes "címek" valódi hierarchikus pozíciót vagy egyfajta spirituális lépcsőfokot jelentettek a hitállapotok ranglétráján."

Miért kéne különválasztani?! A misztériumkultuszok lényege éppen a szimbolikusság. Ha lépcsőfokok vannak a beavatásban, akkor a földi hierarchikus pozícióhoz spirituális státus is tartozik.
De a lényeg az, hogy az adott főpap(nő) létezett. A kérdés csak az, valóban manifesztálódott-e benne az istenség, vagy sem. Ez meg nem természettudományos kérdés.

"Rossz példa, ugyanis a fáraó titulus nemcsak isteni állapotjelző, hanem örökletes cím is volt, emellett a fáraóknak volt önálló neve."

Megint csak OMG. A fáraó titulusa nem volt örökletes, az elsőszülött nem örökölte automatikusan. A fáraó a Maát felügyelőjeként és Hórusz hordozójaként biztosította a földi rend fennállását. Nem fordulhatott elő interregnum, és a hordozó személyét a papság választotta ki. Így az örököst is.

Vallási szempontból tehát nem a cím öröklődött, hanem a rend fenntartása miatt mindenképpen kellett egy élő fáraó, akiben megtestesülhetett Hórusz. Ezért is mumifikálták a fáraót halála után: az egyiptomi felfogás szerint így élhetett.

"A Jézus Krisztus esetében abban sem lehetünk biztosak, hogy ha létezett is az evangéliumok által leírt személy, akkor valóban Jézus Krisztusnak hívták. Simán benne van a pakliban, hogy utólag ragasztották rá ezt a "címet", annak érdekében, hogy bele illeszkedjen az előzetes próféciába és az utólag összeeszkábált vallás rendszerébe. Jézus = megváltó úr, Krisztus = a felkent."

Ilyet nem írtál volna le, ha képben volnál. Nem Krisztusnak hívták, mert az felkentet jelent - ezt jól írtad. Jeshua volt a "keresztneve", Galileai Jeshuaként hivatkozhattak rá, és Jehshua ben Josef, ha a teljes nevén akarták szólítani. A Jézus a Yehshua/Yahshua héber név latin változatának magyar formája - Iesus-Jézus.

"Én is. Csupán arra próbáltam utalni, hogy ha az adott vallás központjában álló személy esetenként egy hús-vér emberként (manifesztáció) is "létezik", maga az imádott személy még akkor is csupán transzcendens koncepcióként van jelen, ami kizárólag a hívők előtt létezik az aktualitásban. A név, a tettek, a tanítás is."

Félig van igazad. Ugyanis az, hogy egy sokadik átiratban milyen név szerepel, mellékes. A tettekről is nehéz eldönteni, mi valós és mi nem. Ez egyébként időtlen jelenség. De alap hiba a fürdővízzel a gyermeket is kiönteni. Tehát a betoldás és az eredeti szétválasztása rendkívül nehéz, ám ez nem ok arra, hogy minden tettet mesének tekintsünk!
A tanítások pedig miért volnának kitaláltak? Jézus nagyon kevés új dolgot tanított, a többséget megtalálod a kortárs fősodorbeli és alternatív zsidó csoportoknál is pl. az esszénusoknál.
Vannak itt is betoldások, meg átírások, de itt jóval könnyebb a dolgunk.

"Oké, ha nem esett volna le a tantusz, az előző hozzászólásomban is azt a gondolatot próbáltam a világra segíteni vajúdó agyadban, hogy a "Jézus korának" nevezett időszak ismeretei alapján nyugodt szívvel kijelenthetjük: Jézus Krisztus már a saját korában is lehetett teljesen kitalált személy (nem csak a nevében, tetteiben és tanításában, hanem a tényleges létezését illetően is) úgy, hogy az alakja körüli kultusz is fennmaradhasson. Ha mindez nem lenne elég, e lehetőségnek a rendelkezésünkre álló források alapján ugyanakkora az esélye, mint annak, hogy a bibliai, valóban isten/istenfia Jézus isteni varázslataival valóban csodákat művelt. Bár a történelmi és kulturális kontextus nyilván más, ugyanez áll Buddhára és Lao-Cere is: abban sem lehetünk biztosak, hogy személyük eredendő koncepciója valóban a koncepcióval azonosítható személytől ("maguktól") vagy csupán az azt kitalálók fantáziájából származik. Az nem érv, hogy ilyen történelmi hatás mögött feltétlenül állnia kellett valakinek a maga egzaktságában. "

Igyekeztem eddig is lassan írni, hogy értelmezni tudd: hatásaik alapján egyik sem lehetett kitalált személy. Lao-ce esetében esetleg több személy olvadt egybe, mint Mózesnél, de ettől még mindegyik létezett.

Jézusnál túl sok a közvetett bizonyíték, ami miatt nem valószínű, hogy kitalált személy lett volna, és a kor gondolkodása és miliője alapján ráadásul nem csupán irreális feltételezni, de egyenesen ostobaság azt vélelmezni, hogy nem élt egy történelmi Jézus.

Amin vitázni lehet az az, hogy valójában mikor született, mit tanított, mit tett, és pontosan hogyan is végeztették ki.

Olyan, mint az evolúció: nem lehet tagadni a változásokat, de lehet vitatni ezek okait, esetleges céljait, irányát, a módokat, szabályokat, stb.

Mystes 2010.12.12. 00:40:54

@Ghavin:
Én elnézést kérek Ghavintól, mert ez tényleg mellékvágánynak tűnik. Mégis azért gondoltam, hogy segítségünkre lehet, mert akkor megértenénk, hogy az ID miért mondja azt, amit mond. Persze, igaz, Tasi István a védikus kozmológiából kiindulva mondja, amit mond...

Mystes 2010.12.12. 00:42:58

@maycontainnuts:
Nagyjából. Nincs ellenhatás hatás nélkül. Nem volt "ID", amíg az evolúcióbiológusok el nem kezdtek arról beszélni, hogy nincs is Isten.

Ziprian 2010.12.12. 00:45:29

Egyébként nem akarok destruktív lenni, de a vallás, az pont olyan, hogy tisztán logikai úton nem lehet bebizonyítani, hogy nem igaz. De azt sem, hogy az.
Egy csomó ilyen állítás van, ezekben vagy hiszel vagy nem.

Jézus létezésén, a Biblia állításain vitázni meddő.

Én egyébként a repülő spegettiszörnyben hiszek. Nem tudtok eltántorítani!

Peter T. Sinclare 2010.12.12. 00:46:47

@VRbagoly: Ghavinnak leírtam már: tudjuk a nevét. Miért ne tudnánk?

Yeshua ben Yosef a galileaiaknak, Galileai Yeshua a szomszédos területek lakosainak.

pounderstibbons 2010.12.12. 00:48:59

Nem mondom, hogy tökéletes válasz a "Jézus-incidensre", de egy református sebész mondta egy interjúban, hogy egyesek szerint létezik ateista magyarázat Jézus feltámadására, miszerint a jókor érkező római katona lándzsája megszabadította Jézust a tüdejében felgyülemlett folyadéktól (ugye víz és vér áradt belőle egyszerre, ami lehet ennek a jele).
Amennyiben Jézus nem fulladt meg és nem halt bele a lándzsa okozta sebbe, elképzelhető, hogy felépült a sérüléséből.
Persze a sebek és a sebfertőzés önmagukban is halálosak lehettek volna, de ha statisztikailag nézzük, miszerint a Rómaiak tízezerszámra feszítették meg az embereket, akkor valakinek csak volt esélye arra, hogy mégis túlélje, hiszen a többi kivégzési mód alól is vannak kivételek.

en.wikipedia.org/wiki/Phineas_Gage
Phineas Gage pl. túlélte, hogy egy több mint egy méter hosszúságú vaslándzsa átszalad az agyán.
Egy keresztény újság még cikkezett is arról, hogy Jézus sem lehet már messze, ha ilyen csodák történnek.

Természetesen a fenti spekuláció sem lehet képes egy vallásos személyt meggyőzni, hiszen Isten csodálatos tette lehet az is, hogy pont Jézus élte túl a megfeszítést.

Peter T. Sinclare 2010.12.12. 00:51:03

@Mystes: Az a szép benne, hogy az Evangéliumokat eredetileg sem szánták történelmi iratoknak. Ezek vallási iratok voltak - jellemzően minden gyülekezetnek volt egy vagy több, amik nem feltétlen egyeztek meg mindenben a többi gyülekezet azonos nevű evangéliumaival -, céljuk a hívők hitbéli megerősítése, a jézusi tanítások (egyre bővülő) továbbadása, stb.

Nem tekinthetők életrajznak - abban a korban egyébként is szerettek mindenütt kiszínezett életrajzokat gyártani.

Mystes 2010.12.12. 00:53:23

@Peter T. Sinclare:
Inkább azt mondták: "a názáreti Jeshua". Ez teljesen szokványos. A származási helyéről nevezni el valakit, és csupán "keresztnevek" voltak. Pl: Kézai Simon. A Kéza, mint helységből származó Simon.

Mystes 2010.12.12. 00:57:37

@pounderstibbons:
Ne keverjük a dolgokat! Feltámadásról akkor van értelme beszélni, ha Jézus tényleg meghalt. Ha nem halt meg, akkor csak "túlélte". Akkor nincs megváltás.

Peter T. Sinclare 2010.12.12. 00:58:29

@Bobby Newmark: "Feljegyzések márpedig nincsenek."

Vannak. Úgy hívják: Jézus-logionok, vagy Jézus-mondások.

Egyébként már Mani is azt tartotta, hogy mennyivel jobb lett volna a helyzet, ha rögtön életében elkészülnek az evangéliumok, mert akkor nem hamisítják meg azokat. Így Mani még életében megírta a kanonikus könyveit, leveleit, stb.

A sors fintora, hogy alig maradt meg mindebből valami.

Vigasztaljon a tudat, hogy a mégannyira ismert görög irodalomnak is csak valami 10% maradt fent, és sok szerzőt és alkotáscímet csupán katalógusokból ismerünk.

Mystes 2010.12.12. 01:00:07

@Peter T. Sinclare:
Képzeld el: bíró vagy, és behívatsz két tanút. Elmondatod velük a történetet.
1., Mire következtetsz, ha szóról szóra ugyanazt mondják?
2., Mire következtetsz, ha nem mondják ugyan szóról szóra ugyanazt, de lényegében megegyeznek?

Peter T. Sinclare 2010.12.12. 01:03:33

@Mystes: csakhogy Iesus Nasarenus. Azaz a Názáret, mint város pont annyira lehetséges magyarázat, mint a nazír - Istennek ajánlott, amilyen Sámson is volt - eredet. Ez viszonylag jó szócikk:

hu.wikipedia.org/wiki/Nazar%C3%A9nus

Peter T. Sinclare 2010.12.12. 01:04:34

@Mystes:
1. betanulták
2. vélhetően azt mondják el, ami szerintük az igazság.

maycontainnuts 2010.12.12. 01:04:40

@Mystes:
"Nagyjából. Nincs ellenhatás hatás nélkül. Nem volt "ID", amíg az evolúcióbiológusok el nem kezdtek arról beszélni, hogy nincs is Isten."

Mutass már erről néhány idézetet. Ha tényleg emiatt jött létre az ID, biztos tele van a korai ID irodalom olyan művekkel amelyekben biológusokat vádolnak azzal, hogy Isten ellen szólnak.

Mellesleg a te gondolkodásod pont ellentétes az ID-vel, mivel szerintük az ID-nek semmi köze sincs semmilyen Istenhez, emiatt nem zavarhatta őket, ha bárki Isten létezését kétségbevonja. Milyen kísértés lehetett ez amerikában, ahol egyes államokban még mindig jogszabály tiltja, hogy ateista töltsön be állami tisztséget?

Szerintük maximum egy furcsa egybeesés csak, hogy nem volt ID, amíg konkrét bírói döntések el nem tántorítottak egyeseket attól, hogy a bibliát (vagy egyéb vallásos irodalmat)akarják erőltetni a biológia tantermekben.

Peter T. Sinclare 2010.12.12. 01:05:54

@Ziprian: a vallás egy társadalmi-kulturális entitás, nem értelmezhető rá az igaz/hamis ellentétpár :) vallási tanításokra már annál inkább, de az meg jellemzően teológiai kérdés.

Mystes 2010.12.12. 01:06:12

@Ziprian:
"Egyébként miért mondod, h irreducibilis az ontológia?"
Nagyjából azt értem ez alatt, hogy az ontológiát nem lehet módszertannal megközelíteni, mint ahogy pl minden tudománynak van saját módszertana. Az ontológiának nincs. Legfeljebb több/féle ontológia van, amit összehasonlíthatunk egymással. Ez persze nem zárja ki, hogy az ontológiai rendszereknek is van valamiféle olyan alapja, amit még megközelíthetünk. Így például a Krisztusban való hitnek is. Az sem a nagy büdös semmiben lóg, hanem történeti alapjai vannak.

Mystes 2010.12.12. 01:09:15

@Peter T. Sinclare:
Inkább mondjuk azt, hogy Názáret és nazir - ugyanarra a (szó)gyökre mennek vissza.

Mystes 2010.12.12. 01:11:02

@Peter T. Sinclare:
1. betanulták
2. vélhetően azt mondják el, ami szerintük az igazság.

Pontosan erről van szó! Ezért nem (ellen)érv, hogy "az evangéliumok ellentmondanak egymásnak". Pont ellenkezőleg! Ez a hitelességük mellett szól. Vagyis: azt mondják, amit igaznak gondolnak.

pounderstibbons 2010.12.12. 01:17:32

@Mystes:
Ez a feltámadás zűrös ügy.
És nem csak nekem, hanem bármelyik keresztény vallásnak is.

Ha Isten mindenható akkor nem kellett volna megölnie a fiát a bűnbocsánat eléréséhez. Meg különben is eléggé kiszúrás szegény gyerekkel. Nem is beszélve az anyjáról.
Ami ugye meg Isten jóságosságával megy szembe.
Ha pedig a mennyek országa annyira remek hely, akkor nem értem mi volt a nagy etwas Krisztus szenvedésében. Milliárdok haltak meg Krisztus előtt és után is, néha sokkal rosszabb körülmények között, és ők nem tudták biztosra, hogy visszatérnek illetve a mennybe kerülnek. Így meg eltűnik az áldozathozatal része.

Nekem pl. szimpatikusabb lenne egy Isten, aki maximum tetszhalálba küldi a fiát, hogy mondjuk rajta kersztül megtapasztaljon egy fájdalmas halálélményt, vagy a bűnösökkel együttérzést (Jézus+lator!) utána pedig elengedi a kezét és azt mondja, hogy "jó gyerek voltál, megtetted, amire kértelek, mehetsz Isten hírével és kezdj az életeddel amit csak tudsz".

Nekem egy teljesen jófej Istennek tűnne az ilyen, és az erre épített szekta se lenne szerintem rosszabb bármely más szektánál.

Ahogy a szeplőtelen Mária legendája nélkül is lehet hinni, meg azzal együtt is, ugyanígy a feltámadás is egy nélkülözhető elem szerintem a kereszténységhez.

Nekem ami szépnek és hasznosnak tűnik a Bibliából, az egy mondat, miszerint felebarátaiddal tedd azt, amit akarsz, hogy veled tegyenek.
Ez egy mai napig korszerű és általam is vallott alapelv.

Bocs ha hosszú voltam.

Mystes 2010.12.12. 01:19:56

@maycontainnuts:
Én kifejezetten mondtam, hogy az ID akár nem tudatos ellenhatás az evolúcióbiológusok ontológiai/világnézeti túlkapásaira. Nem kell, hogy (konkrét) citátumokat találjunk a korai ID-művekben. Mindamellett szerintem az ID igenis ontológiai alapon támadja az evolúciót, ami egy biológiatörténeti kérdés. Hogy aztán ezt az ontológiát honnan merítik, a Védákból, a Bibliából vagy máshonnan (ugyanis a mohamedánok között sem népszerű az evolúció), az már nem is számít.

Mystes 2010.12.12. 01:26:37

@pounderstibbons:
1., "Ha Isten mindenható akkor nem kellett volna megölnie a fiát a bűnbocsánat eléréséhez. "
Ez egy nagy kérdés.

2., Milliárdok haltak meg Krisztus előtt és után is, néha sokkal rosszabb körülmények között, és ők nem tudták biztosra, hogy visszatérnek illetve a mennybe kerülnek. Így meg eltűnik az áldozathozatal része."
Éppen ezért nem tudta Jézus sem.

3., "a feltámadás is egy nélkülözhető elem szerintem a kereszténységhez."
Akkor mi nélkülözhetetlen?

ghavin 2010.12.12. 01:26:52

@Peter T. Sinclare: "OMG. A lényeg a közvetettség. Az, hogy közvetett bizonyítékok alapján következtetünk arra, hogy van/volt ott valami, ami hatással van/volt a környezetére. Mit kell ezen túlragozni?"

Azt, hogy míg az exobolygó létére utaló bizonyítékok közvetlenül az exobolygóra mutatnak, addig a mitikus alak keltette hatásokból nem feltétlenül következük az alak egzakt léte.

"Valóban az volna?"

A megváltó messiás koncepciója a számtalan egyéb profetikus mítosz mellett marginális, sőt mi több, már-már banális. Az sem változtat ezen, hogy csak nagyon kevés ilyen koncepcióból alakul ki "történelemformáló" világvallás, s Jézus éppenséggel ezek közé tartozik.

"Na, mondj két példát."

Abu Isa, s mondjuk a szinkretizmus korának összes Ízisz-főpapnője.

"Miért kéne különválasztani?!"

Mert így nyilvánvaló, hogy a spiritualitásnak nem feltétele a manifesztáció, mégis a manifesztáció képezte a vallás alapját, ami viszont esetleges volt. Pont, mint a kereszténységnél. Egy szinkretista Ízisz-templom főpapnője, tehát a manifesztálódott Ízisz nélkül is tökéletesen "működött". Ha vallást akarnék alapítani, bizonyára én is a leggyakorlatiasabb módszereket lopkodnám össze, ennél gyakorlatiasabb megközelítését az isteni reprezentációnak pedig aligha találni.

"Megint csak OMG. A fáraó titulusa nem volt örökletes, az elsőszülött nem örökölte automatikusan."

Akkor átöröklődik, tök mindegy, az idézett bekezdésemnek nem is ez volt a lényege.

"Jehshua ben Josef, ha a teljes nevén akarták szólítani. "

Biztos csak szerencsés egybeesés volt, hogy a Jézus héber eredetije megváltót jelent :) Ugyan...

"De alap hiba a fürdővízzel a gyermeket is kiönteni."

Ha a gyerek nem gyerek, hanem egy darab szar, amit "történelmi személynek" próbálnak sunyi módon átcímkézni, én azért kihúznám a dugót.

"Igyekeztem eddig is lassan írni, hogy értelmezni tudd: hatásaik alapján egyik sem lehetett kitalált személy."

Amennyire a lassú írás nem befolyásolja a mondanivalód értelmezhetőségét, legalább annyira lényegtelen a hatás is, amibe ennyire kapaszkodni próbálsz. Egész könyvtárak vannak tele fiktív figurák "hatásával", köztük olyan leleteket felsorakoztató tudományos munkákkal, amelyekkel a kortárs hívők épp annyira imádatuk tárgyának létezését próbálták igazolni, mint ahogyan jelenleg itt is történik a bibliai varázshippi kapcsán.

maycontainnuts 2010.12.12. 01:29:18

@Mystes:
"Mindamellett szerintem az ID igenis ontológiai alapon támadja az evolúciót, ami egy biológiatörténeti kérdés. Hogy aztán ezt az ontológiát honnan merítik, a Védákból, a Bibliából vagy máshonnan (ugyanis a mohamedánok között sem népszerű az evolúció), az már nem is számít."

Akkor te most vagy nem ismered, vagy lehazugoztad az ID-t.

Merthogy ilyeneket írnak:
"Fontosnak tartom megjegyezni, hogy az intelligens tervezés elméletét szakképzett természettudósok dolgozták ki az elmúlt évtizedekben, a molekuláris biológia és más tudományágak tudásanyaga alapján. Ez a megfigyeléseken és következtetéseken alapuló alternatív nézet módszertanát és állításait tekintve alapvetően különbözik a kreacionizmustól, amely a bibliai teremtéstörténetet tekinti kiindulási alapnak."

"Az intelligens tervezés tehát egy empirikus alapon álló alternatív tudományos gondolat, amely szerint az élővilág egyes jellegzetességei értelmes tervezés révén magyarázhatóak meg legjobban, nem pedig véletlenszerű természeti folyamatok eredményeképpen. Kijelentései között semmi olyan nem szerepel, amely a bármely felekezet speciális tanítása lenne, maximum csupán egy filozófiai értelemben vett teizmus felé mutat."

"Amikor az ID megfogalmazza elméleteit, nem hivatkozik semmilyen vallásos írásra. Számos ID-párti tudósról közismert, hogy nem vallásos, vagy vallásos szemlélete jócskán eltér a tudományos téren képviselttől. Az ID tudósai tehát nem egy vallásos szemléletmód vagy szentírás támogatói, hanem azt állítják, hogy a tervezettség a természeti tárgyak tanulmányozása révén, tudományos módon felismerhető."

Mind az Értem weblapjáról vett idézet ("kreacionizmus"-ra keresve megtalálhatóak)

Mystes 2010.12.12. 01:42:58

@Ghavin:
"Biztos csak szerencsés egybeesés volt, hogy a Jézus héber eredetije megváltót jelent :) Ugyan..."

A Jeshua név annyit jelent: "Jahve a szabadító". Ez egy teljesen szokványos név. Nemcsak annyiban, hogy a zsidó nevek többségében Jahve, vagy annak rövidített formája szerepel, hanem annyiban is, hogy Jézus korában még rengeteg más embert is hívtak Jeshouának. Ez olyan, mintha valakit ma nálunk Józsinak hívnának. Minden utcasarkon van belőle egy. Nem áll tehát az az érved, hogy már a neve is csalásra utal...

pounderstibbons 2010.12.12. 01:45:40

@Mystes:
"Akkor mi nélkülözhetetlen?"

Hát Krisztus elengedhetetlen belőle, ha már róla lett elnevezve.
Krisztust a Bibliából lehet megismerni, hacsak nem folyamodunk a Mormonok fantasztikus ötlettárához, tehát az is kell bele, de innentől kezdve szabadon választott.
(Az általam idézett mondat pedig hasznos ha benne van.)
De ez csak az én ötletelésem.
De nyugodtan mondd el, hogy az én korábbi bibliamagyarázatom szerinted miért nem lenne keresztény.

A keresztény vallásokat elhatárolni a nem keresztény vallásoktól azonban majdnem annyira lehetetlen, mint a fajokat. Pl. a Moon szektában van Biblia, meg Jézus, de eléggé mellékszereplő szinten a szektaalapítóhoz képest.
De ha új vezetőjük lesz, aki Krisztust emeli ki inkább, akkor máris felborult az egyensúly.
www.lmrkat.hu/szektak.html#moon
(ui: az milyen durva már, hogy az oldalon egy kattintással ki lehet lépni itt a katolikus egyházból? Még egy játék is rákérdez kétszer, mielőtt uninstallálom.... :) )

Mystes 2010.12.12. 01:53:25

@maycontainnuts:
Igazad van, tegyünk éles különbséget a kreacionizmus és az ID között. Tény azonban, hogy mind a bevett evolúciós tan, mind az ID ontológiai fogalmakkal operál. Darwin azt mondja: "véletlen". Az ID azt mondja: "nem véletlen, hanem tudatos tervezés". Ezek egyaránt ontológiai kifejezések! Ugyan milyen alapon tudnánk dönteni a kettő között? Az ID látens teista, a darwini tanok látens ateista.

Opett 2010.12.12. 02:10:28

@maycontainnuts: "Akkor te most vagy nem ismered, vagy lehazugoztad az ID-t."

Inkább utóbbi. Aki utánajárt a témának, tudhatja, hogy az Intelligens Tervező Isten fedőneve. Tasi esetében Krisnát meg Visnut, bár általában Jehovát meg Jézust takarja.

Mystes 2010.12.12. 02:10:29

@pounderstibbons:

1., Feltámadás nélkül azonban Jézus nem válik Krisztussá...

2., A mormonok csak egy példa, de örülök, hogy hoztad, mert semmiben nem különböznek a mohamedánoktól. Ott is van Jézus, de mellékszereplőként. A főszereplő ott Mohamed.

maycontainnuts 2010.12.12. 02:12:29

@Mystes:
Az evolúció nem látens ateista.
Rengetegen elmondták már, hogy az ő hitükkel az evolúció teljesen megfér. Legyen az a hit Teizmus, Deizmus, vagy uram, bocsá' ateizmus. (pl. lásd feljebb Falus András)
Az ateista "tólkapásokat" bőven lehet kritizálni az evolúcióelméleten belülről is.

És ez szerintem így is van rendjén.

Az ID "látens teizmusa" is fura, mivel máshol azt is közlik, hogy ők akár azt is elfogadják, hogy a Tervező egy Ufó, mert annyira nem tudnak/akarnak semmit se mondani a Tervezőről.

ertem.hu/page/vilagnezetek-kordiagramon/

De persze erre lehet azt mondani, hogy az ID egy ellencsapásként jött létre, mert a tudósok nem hisznek eléggé az Ufókban, csak ennek ellentmond pl. a SETI program, meg a Drake egyenlet... :D

Mystes 2010.12.12. 02:14:47

@Opett:
Én nem azt mondtam, hogy az ID "hazug". Azt mondtam, hogy vannak ontológiai előfeltevései, még ha ennek esetleg nincs is tudatában. Ugyanez bizonyos értelemben a bevett evolúciós tanra is igaz. A természettudomány ugyanis azt mondja: megmagyarázom a világot Isten nélkül. Nincs rá szükségem. Erre én: oké, tedd azt! De honnan veszed, hogy nincs?

Mystes 2010.12.12. 02:24:34

@maycontainnuts:
Amennyiben a darwinisták és az ID is szigorúan elzárkózik attól, hogy ontológiai kijelentéseket tegyen, azt jól teszik. De. Lehet-e? Hiszen, mint mondtam, tanaik alapvető részeit képezik az olyan, nem tudományos, hanem ontológiai állítások, mint: "véletlen", "tudatos/intelligens", stb.

pounderstibbons 2010.12.12. 02:25:29

@Mystes:
"1., Feltámadás nélkül azonban Jézus nem válik Krisztussá..."

Krisztosz mintha valami olajjal felkentet jelentene. Olyanja meg volt nekije, nem?
Vagy a messiási (megváltói) értelemben gondolod, akkor annak is megfelel szerintem a tetszhalott Jézusos elméletem.
Ő volt megbízva, hogy bevállalja a kereszthalált, hát bevállalta, cserébe az Isten megint szereti az embereket, sőt nem csak a zsidókat, hanem másokat is.
Happy End.

Tényleg örülnék, ha rámutatnál, hogy hol nem keresztény az én általam felvázolt vallás, amiben Jézus nem halt meg a kereszten.

pounderstibbons 2010.12.12. 02:27:20

jav: kereszt-tetsz-halált vállalta be

Opett 2010.12.12. 02:36:47

@Mystes: "De honnan veszed, hogy nincs?"
0. Occam féle beretva. Honnan veszed, hogy a gravitáció nem csupán apró láthatatlan manók működésének eredménye, akik összebeszéltek, hogy úgy húzzanak minket le, mintha a gravitáció működne? Ontológiailag nem tudhatjuk, hogy nincsenek ilyen manók. A tudás szó praktikus használata szerint viszont bármikor ki merem mondani, hogy TUDJUK, ilyen manók nincsenek.
1. Nincs rá bizonyíték. Pedig lehetne, nagyon is könnyen.
2. Az emberek, akik azt állítják, hogy létezik, és kapcsolatban vannak vele, rendszeresen ellentmondásban vannak. Nem kicsit.
3. Az emberek, akik érvelnek mellette, gyakran használnak logikai hibákat, valótlan állításokat, vagy tipikus szélhámos, és agymosó technikákat, (néha tudtukon kívül).

Lehetne még sorolni.

Mystes 2010.12.12. 02:57:52

@pounderstibbons:
1., A khrisztosz tényleg olajjal felkentet jelent. Nem tudunk róla, hogy felkenték volna. Miért is tették volna? Életében sohasem hívták így. Ez egy úgynevezett méltóságcím. Olyan, mint a "Királyok Királya" például.

Az ilyen címekkel próbálták kifejezni azt az állapotot, amibe feltámadásával került. Ezzel foglalkozik (a teológián belül) az úgynevezett krisztológia.

2., Ha Jézus nem halt meg _tényleg_, akkor nem győzetett le a Halál.

Egyébként a tetszhalott-elmélet nagyon korán felbukkant bizonyos gnosztikus csoportoknál, akik szintén képtelenek voltak elfogadni a Misztériumot. Mindenképpen valami racionális megoldást akartak keresni a hitre...

Mystes 2010.12.12. 03:06:45

@Opett:
0., A manós példa nem jó. Egyáltalán NEM TUDJUK, hogy Isten nincs. Honnan is tudnánk?
1., Itt már nem tudom, mire utaltál vissza. Ezért nem tudok reagálni.
2., Na és? Mi van akkor, ha ellentmondásban vannak? Ki mondta, hogy a hit(élet) mindig, mindenkor ellentmondásmentes? Nem matematika ez!
3., Senki nem mondta, hogy a hitélet "hibátlan". De, más se!

maycontainnuts 2010.12.12. 04:51:13

@Mystes:
Ha Khrisztosznak a halálból feltámadókat nevezték volna, akár igazad lehetne. De még perzsa királyt is hívnak khrisztosznak /messiásnak a bibliában, nem értem miért kellett volna meg is halni a valakinek a cím elnyeréséért.
en.wikipedia.org/wiki/Messiah
(korábban meg mintha az asszonyok is kenték volna haját olajjal, de az lehet, hogy nem ér :) )

Krisztológia az egész Krisztussal foglalkozik, aminek egy eleme a halála, de messze nem az egész.

" Ha Jézus nem halt meg _tényleg_, akkor nem győzetett le a Halál."

Miért, most úgy érzed, hogy le van győzve? Hány ismerősöd támadt fel mostanában?
Nem elég, hogy a Fiú vállalt valamit és cserébe bejuthatsz a mennyek országába rajta keresztül? Feltétlenül kell hozzá neked ez a hitvány test is? Micsoda naturalista hozzáállás ez kéremszépen. :)

maycontainnuts 2010.12.12. 05:09:52

@Mystes:
"0., A manós példa nem jó. Egyáltalán NEM TUDJUK, hogy Isten nincs. Honnan is tudnánk?"

A manókról tudjuk, hogy nincsenek? És ha jövőre kijön egy mégújabb testamentum manókkal? Vagy előkerül egy mégkumránibb tekercs?

"Amennyiben a darwinisták és az ID is szigorúan elzárkózik attól, hogy ontológiai kijelentéseket tegyen, azt jól teszik."

A tudomány keresi az okokat a természetben, és a biológiában még nem akadt olyan elemre, amelyik értelmes tervezettséget kizáróan tervezett lett volna. Az ID állítja, hogy talált ilyet, de eddig minden kisérletük, amikor ezt igazolni próbálták, elbukott, sőt, minden egyes újabb próbákozásuk csak egy újabb tudományos eredménynek köszönhető.

Ha az ID hívei feltalálnának pl. valami hasznosat, a saját mániájuk alkalmazása révén az egész komoly érv lenne mellettük.
Te el tudsz képzelni ilyet?

Ugyanígy nem tudok olyat se elképzelni, hogy a tudomány állít valamit, és ne lehessen rávágni azonnal, hogy "De ezt VALAKI direkt csinálja!" (manók, Isten, Sai Baba).
Sőt, ezt a mondatot nem csak a biológiában, hanem bármely más tudományágban is be lehet vetni, továbbmegyek, bármilyen tartalmú állításra, és azok ellenkezőjére is.
Pont ezért, ennek a kijelentésnek az információtartalma tökéletesen nulla.

Mystes 2010.12.12. 11:21:52

@maycontainnuts:
1., "Ha Khrisztosznak a halálból feltámadókat nevezték volna, akár igazad lehetne. De még perzsa királyt is hívnak khrisztosznak /messiásnak a bibliában, nem értem miért kellett volna meg is halni a valakinek a cím elnyeréséért."
Ha még csak meghalt volna, nyilván nem érdemelte volna ki a címet :)

2., "(korábban meg mintha az asszonyok is kenték volna haját olajjal, de az lehet, hogy nem ér :) )"
Akkoriban ezt használták hajbalzsamnak :)

3., "Krisztológia az egész Krisztussal foglalkozik, aminek egy eleme a halála, de messze nem az egész."
Inkább úgy mondanám, hogy a krisztológia a méltóságcímekkel foglalkozik.

4., "Nem elég, hogy a Fiú vállalt valamit és cserébe bejuthatsz a mennyek országába rajta keresztül? Feltétlenül kell hozzá neked ez a hitvány test is? Micsoda naturalista hozzáállás ez kéremszépen. :)"
Hja kérem! Engem csak a test érdekel! :)

Mystes 2010.12.12. 11:31:48

@maycontainnuts:

1., "A manókról tudjuk, hogy nincsenek?"
Én egyáltalán nem mondtam, hogy tudnánk, hogy nincsenek. Én pl elég sokat szoktam a kertekben is látni, csak még nem döntöttem el, hogy manók-e? :)

2., "Te el tudsz képzelni ilyet?"
(Sajnos) nem tudok ebben a kérdésben nyilatkozni.

3., "Ugyanígy nem tudok olyat se elképzelni, hogy a tudomány állít valamit, és ne lehessen rávágni azonnal, hogy "De ezt VALAKI direkt csinálja!" (manók, Isten, Sai Baba).
Sőt, ezt a mondatot nem csak a biológiában, hanem bármely más tudományágban is be lehet vetni, továbbmegyek, bármilyen tartalmú állításra, és azok ellenkezőjére is.
Pont ezért, ennek a kijelentésnek az információtartalma tökéletesen nulla."
Általában a leglényegesebb kérdésekkel így vagyunk! Annyira absztraktak a válaszok, hogy nem sok mindent tudunk velük kezdeni...

Mystes 2010.12.12. 15:17:49

Persze, ha azt vesszük, hogy pl Heribert Illignek sikerült 300 évet eltüntetnie a történelemből, ugyan mit csodálkozunk azon, hogy egyesek ma már, mintegy 2000 év elmúltával, egyenesen kétségbe vonják XY létezését (is)? Egykutya! :)

Mystes 2010.12.12. 15:28:21

@Mystes:
Ugyanezeknek az emberekenek persze semmi problémát nem okoz az evolúció igencsak hosszas történelmét elképzelni. No comment :)

pszeudozsiráf 2010.12.12. 15:36:01

@Mystes:

Az evolucióelmélet (és a természettudomány) nem abból indul ki, hogy meg tudom magyarázni a világot isten nélkül, eleve nem indul ki egy pozitív vagy negatív hitből.
A természettudomány leegyszerűsítve ezt mondja:
Vizsgáljuk azokat a dolgokat amik megfigyelhetők és tesztelhetők, erről állítsunk fel modelleket és elméleteket. Teszteljük a modelleket, és amiknek a megfigyelések ellentmondanak azt vegyük ki az elméletből, vagy változtassunk az elméletet, esetleg vessük el teljesen. A tudomány eleve nem foglalkozik olyan állításokkal amik nem tesztelhetők, mert ha így lenne akkor bármiről be lehetne bizonyítani bármit vagy annak ellenkezőjét is.

Tehát eleve nem is számol a tudomány Istennel, sem úgy mint létező, sem úgy mint nem létező. Mint ahogy abból sem indul ki hogy zempülöfök nem léteznek. Tehát a sorrend valahogy úgy van: Megfigyelünk, vizsgálunk, tesztelünk. Ha közvetlenül megfigylejük zempülöföt, akkor felvesszük a modellbe, ha a tesztek alapján a modell indokolja, hogy felvegyünk egy zempülöföt, akkor szintén felvesszük, viszont ha a modell önmagában jó magyarázat a megfigyelésekre, akkor eleve nem is számolunk vele... Ugyanúgy ahogy unikornisokkal, vagy hétfejű sárkányokkal sem. -> Ocham borotvája.

Az hogy ebből ontológiai kijelentés is születhet, az már filozófia, naturalizmus. Ilyen szempontból külön kell választani a módszertani és a filozófiai naturalizmust.

Mystes 2010.12.12. 15:45:15

@equalizer:
Nagyjából egyetértek. (Annyi kiegészítéssel, hogy ontológiai alapok nélkül nem megy a dolog, hiszen már az is egy [ontológiai] döntés, hogy, ahogy írod, módszertanában nem indul ki semmilyen pozitív vagy negatív hitből, pusztán megfigyelésből.) Annyit tennék hozzá, hogy a természettudományokban ez a szimpla módszer még eléggé bejön, a szellemtudományokban már sokkal kevésbé, aztán ahogy haladunk felfelé, a még rázósabb kérdések felé, ott meg már végképp becsődöl.

Sok hiba onnan származik, hogy a szimpla természettudományos módszert olyan területeken is alkalmazni akarják, ahol azt már nem lehet.

GalBob 2010.12.12. 15:55:58

@Mystes: Ugyan nézz már utána, hogy hányan írtak bárminemű isten nélküli ontológiát. Tényleg nem értem, hogy miért pattogsz ezen.

"Sok hiba onnan származik, hogy a szimpla természettudományos módszert olyan területeken is alkalmazni akarják, ahol azt már nem lehet."

Például?

Opett 2010.12.12. 15:58:51

@Mystes: Ha milliók hinnének a gravitációs manókban, és S. Hawking azt írná: Minden valószínűség szerint nincsnek manók, akkor is panaszkodnál, hogy Hawking túllép a tudomány határán, és ontológiai kijelentéseket tesz, meg dogmákat állít fel?

Mystes 2010.12.12. 16:00:38

@Opett:
Hawking pont jó példa arra, hogy mi történik, ha egy természettudós teljesen saját módszertanának foglya lesz.

GalBob 2010.12.12. 16:05:28

@Mystes: Inkább a kérdésre válaszolj, a demagógia ráér később is.

Mystes 2010.12.12. 16:06:53

@GalBob:
1., "Ugyan nézz már utána, hogy hányan írtak bárminemű isten nélküli ontológiát."
Sokan.

2., "Sok hiba onnan származik, hogy a szimpla természettudományos módszert olyan területeken is alkalmazni akarják, ahol azt már nem lehet."

Például?

Például olyasmi, hogy valaki azzal akarja cáfolni egy irodalmi/történelmi mű érvényességét, hogy "abban sok az ellentmondás". "A Háború és Béke azért rossz és hiteltelen mű, mert sok benne az ellentmondás." Hát micsoda egy hülyeség ez? Az ellentmondásmentesség egy természettudományos módszertani követelmény, amit csak adott körön belül lehet használni...

GalBob 2010.12.12. 16:13:36

@Mystes: "Sokan."

És ez szerinted nem bizonyíték arra, hogy amennyiben általánosságban beszélünk az ontológiáról, akkor már eleve nincs értelme egységes, szilárd alapról beszélni? Továbbá azt is megindokolhatnád végre, hogy tudományos alapról miért nem lehet ontológiai párbeszédet folytatni.

"Például olyasmi, hogy valaki azzal akarja cáfolni egy irodalmi/történelmi mű érvényességét, hogy "abban sok az ellentmondás". "A Háború és Béke azért rossz és hiteltelen mű, mert sok benne az ellentmondás." Hát micsoda egy hülyeség ez? Az ellentmondásmentesség egy természettudományos módszertani követelmény, amit csak adott körön belül lehet használni..."

Az ellentmondás kérdése csak és kizárólag akkor merül fel, amikor a magadfajta a apologéták megpróbálják bármilyen értelemben kész tényként interpretálni Jézus létezését. Amennyiben a Bibliát irodalmi műként, a vallásos hiedelmek összhalmazát pedig mitológiának tekintjük, akkor nyilván "hülyeség" következetességet keresni, csak ugye ezt nem hagyjátok.

Mystes 2010.12.12. 16:14:01

@GalBob:
"Inkább a kérdésre válaszolj, a demagógia ráér később is."

Erre gondolsz?

"Ha milliók hinnének a gravitációs manókban, és S. Hawking azt írná: Minden valószínűség szerint nincsnek manók, akkor is panaszkodnál, hogy Hawking túllép a tudomány határán, és ontológiai kijelentéseket tesz, meg dogmákat állít fel?"

Ha igen, akkor megpróbálok válaszolni: mi éppen 2010-et írunk, szerintünk a "világ teremtésétől" eltelt vagy 4,6 milliárd év. A zsidók szerint azonban ötezervalahányszáz év telt el a világ létrejövetele óta, ennyiedik év van most. Zavar ez valakit? Nem. Ha repülőgépjegyet veszel Tel-Avivba, akkor biztos, hogy pontosan fogsz megérkezni? Igen.

Mi ehhez képest egy (kis) manóprobléma? Semmi!

GalBob 2010.12.12. 16:17:56

@Mystes: Továbbra sem válaszoltál a kérdésre. Hawking a manók ügyének tárgyalásával túllépne-e a tudomány határán vagy sem? Valóban ontológiai kérdéseket tesz fel vagy sem? Valóban dogmákat állít fel vagy sem?

Kiegészíteném még azzal a kérdésemmel, hogy "ontológiailag" mi a különbség a manók és isten között, már ha van egyáltalán?

Mystes 2010.12.12. 16:23:20

@GalBob:
1., "Azt is megindokolhatnád végre, hogy tudományos alapról miért nem lehet ontológiai párbeszédet folytatni."
Ugyan már miért ne lehetne? Mondtam én ennek az ellenkezőjét?

2., "Az ellentmondás kérdése csak és kizárólag akkor merül fel, amikor a magadfajta a apologéták megpróbálják bármilyen értelemben kész tényként interpretálni Jézus létezését. Amennyiben a Bibliát irodalmi műként, a vallásos hiedelmek összhalmazát pedig mitológiának tekintjük, akkor nyilván "hülyeség" következetességet keresni, csak ugye ezt nem hagyjátok."
Hogyhogy nem hagyjuk? Micsoda egy hülyeség ez már megint? Nagyon jó kis műveket írtak már a Bibliáról, nagyjából a felvilágosodás óta, amikben röhejesen kifigurázták az egész tarthatatlanságát! Sőt, nyugodtan visszamehetünk még korábbra is: Mohamed is megmondta, hogy nem oda Buda! Újabban meg, épp valaki mondta a Moon-ék is megalkották a maguk variációját. Már hogyne volna itt tere a kritikának meg az átiratoknak, kérem!

Opett 2010.12.12. 16:23:47

@Mystes: Már nem ez az első eset, hogy kerülöd a választ, vagy megpróbálod elviccelni. Gyakori szimptóma ez, mikor vallásos emberekkel, barátaimmal beszélgetek. Szerintem azért, mert ha őszintén válaszolnál, az még neked is rávilágítana az állításaid, világképed abszurdságára.

Mystes 2010.12.12. 16:36:23

@GalBob:
1., "Hawking a manók ügyének tárgyalásával túllépne-e a tudomány határán vagy sem? Valóban ontológiai kérdéseket tesz fel vagy sem? Valóban dogmákat állít fel vagy sem?"
Hawking okosabb annál, hogy ilyesmit tegyen. Ő nem azzal foglalkozik, hogy "mi van" és "mi nincs", hanem azzal, hogy ami van, de legalábbis számára érzékelhető, az milyen. Valljuk be, ez sokkal könnyebb, mint lételméleti kérdésekkel foglalkozni...

2., "Kiegészíteném még azzal a kérdésemmel, hogy "ontológiailag" mi a különbség a manók és isten között, már ha van egyáltalán?"
Annyi, amennyi az e kettőbe vetett hit különbsége.

Mystes 2010.12.12. 16:37:56

@Opett:
Mire is gondolsz pontosan?

Mystes 2010.12.12. 17:10:04

"Kölyökkoromban minden este imádkoztam egy új bicikliért. Aztán rájöttem, hogy az Úr nem így dolgozik.
Loptam egy biciklit és utána fohászkodtam, hogy bocsássa meg bűnömet."

Hol van itt az ellentmondás? :))))))))

Opett 2010.12.12. 17:14:29

@Mystes: pl. A manós kérdésre. Ha komolyan válaszolnál, szerintem te is beláthatnád, hogy azt állítani, hogy valószínűleg nincsenek gravitációs manók, nem dogmatikus. Ugyanúgy meg lehet tenni ezt az állítást más mitológia, kitalált lényekkel, istenekkel.
Az én manóim és a te istened közt csak annyi a különbség, hogy az egyikben emberek milliói hisznek. Semmi több.

GalBob 2010.12.12. 17:21:21

@Mystes: "Valljuk be, ez sokkal könnyebb, mint lételméleti kérdésekkel foglalkozni..."

Szerintem meg az ontológiai random bullshit-gyártás ezerszer könnyebb, mint érdemben a létezők összességével, tehát az univerzum természetével foglalkozni. Tökmindegy, ez újfent nem tekinthető érvnek a részedről, csupán elsütöttél egy újabb lózungot.

"Annyi, amennyi az e kettőbe vetett hit különbsége."

Nem az volt a kérdés, hogy mennyi, hanem hogy mi az és hogy van-e egyáltalán. A kérdésre válaszolj, s fejezd be az állandó mellébeszélést.

Peter T. Sinclare 2010.12.12. 17:25:26

@Ghavin: "Azt, hogy míg az exobolygó létére utaló bizonyítékok közvetlenül az exobolygóra mutatnak, addig a mitikus alak keltette hatásokból nem feltétlenül következük az alak egzakt léte."

Légyszíves fejezd be a tisztességtelen csúsztatásokat! Történelmi és nem mitikus alakokról beszéltünk. A történelmi alakok keltette hatásokból egyértelműen következik egy, vagy több történelmi alak, mint a hatások forrásának megléte.

Jézus Krisztus mitikus alak - ha már a görög vallás istenei is mitikusak -, Jehshua ben Josef/Galileai Jehshua ellenben valós történelmi alak volt.

"A megváltó messiás koncepciója a számtalan egyéb profetikus mítosz mellett marginális, sőt mi több, már-már banális. Az sem változtat ezen, hogy csak nagyon kevés ilyen koncepcióból alakul ki "történelemformáló" világvallás, s Jézus éppenséggel ezek közé tartozik."

Az a koncepció, ami olyan mértékben határozta meg a történelmet, amit nagyon minimálisan már szemléltettem, nem LEHET marginális!
A vallási koncepciókon belül szintén nem marginális, ha adott vallásoknál ez központi elemmé válik.

Marginális az a koncepció, ami minimális hatást gyakorol és egyébként se nagyon foglalkoznak vele.
A demonológia/ördögűzés pl. marginális koncepcióvá vált a huszadik század végi-huszonegyedik század eleji rómkat kereszténységben.

"Abu Isa, s mondjuk a szinkretizmus korának összes Ízisz-főpapnője."

Az összes Ízisz-főpapnő létezett. Legfeljebb kiderült róluk, hogy nem messiások.
Abu Isa szintén történelmi alak, csak éppen róla is kiderült, hogy állításával szemben nem Megváltó.

Látom, megint kevered a dolgokat... az, hogy egy történelmi alak messiásnak mondja magát, aztán kiderül, hogy nem az, attól még nem válik nemlétezővé a történelmi alak! Legfeljebb annyit mondhatunk: az illető nem volt messiás.

"Mert így nyilvánvaló, hogy a spiritualitásnak nem feltétele a manifesztáció, mégis a manifesztáció képezte a vallás alapját, ami viszont esetleges volt."

Talán mert a kettő nem függ egymástól? Másrészt honnan veszed azt, hogy a manifesztáció képezné a vallás alapját? Melyikét? A kereszténységét pl. nem. Hiszen Jézus nem mondta, hogy benne testesült volna meg Jahve Fia! Nem is mondta magát istenségnek, vagy Istennek. Messiásnak vallotta magát.

Az egyiptomi vallás alapja sem az, hogy a Fáraóban megtestesül Hórusz.

"Pont, mint a kereszténységnél. Egy szinkretista Ízisz-templom főpapnője, tehát a manifesztálódott Ízisz nélkül is tökéletesen "működött". Ha vallást akarnék alapítani, bizonyára én is a leggyakorlatiasabb módszereket lopkodnám össze, ennél gyakorlatiasabb megközelítését az isteni reprezentációnak pedig aligha találni."

Mint írtam, Jézus nem vallotta, hogy benne manifesztálódna bármi is! Legfeljebb azt, hogy ő a Kiválasztott.

"Akkor átöröklődik, tök mindegy, az idézett bekezdésemnek nem is ez volt a lényege."

Innentől annulálódik is az, amit állítottál.

"Biztos csak szerencsés egybeesés volt, hogy a Jézus héber eredetije megváltót jelent :) Ugyan..."

Mivel jellemzően beszélő neveket használtak régen, ez nem sok mindent jelent. Caligula pl. Csizmácska. Van róla korabeli anekdota, miért ez lett, de vajon uralmát a csizmácska szó jellemezte?

Vagy aki ma Kovács nevet visel, annak feltétlen fémipari szakmunkásnak kell lennie?

"Ha a gyerek nem gyerek, hanem egy darab szar, amit "történelmi személynek" próbálnak sunyi módon átcímkézni, én azért kihúznám a dugót."

Egyelőre semmiféle ellenérved nem állta meg a helyét. Jézus, mint történelmi alak létezett.

"Amennyire a lassú írás nem befolyásolja a mondanivalód értelmezhetőségét, legalább annyira lényegtelen a hatás is, amibe ennyire kapaszkodni próbálsz. Egész könyvtárak vannak tele fiktív figurák "hatásával", köztük olyan leleteket felsorakoztató tudományos munkákkal, amelyekkel a kortárs hívők épp annyira imádatuk tárgyának létezését próbálták igazolni, mint ahogyan jelenleg itt is történik a bibliai varázshippi kapcsán. "

Megint félrebeszélsz. Galileai Jehshua létezett, tanított, hívei voltak, megölték. Mivel politikailag marginális figura volt, egyike a sok önjelölt messiásnak, természetes, hogy a kortársak nem foglalkoztak vele.

Ettől még létezett, mert csak létező személynek vannak tanítványai, rokonai, mondásai, hívei és ellenségei.

ghavin 2010.12.12. 17:44:20

@Peter T. Sinclare: "Történelmi és nem mitikus alakokról beszéltünk."

Mivel éppen ezt próbáljuk eldönteni, ne kerekítsünk már hirtelen axiómát a vitatott állításról.

"A történelmi alakok keltette hatásokból egyértelműen következik egy, vagy több történelmi alak, mint a hatások forrásának megléte."

Számodra egyértelműen következik, számomra meg nem. Utóbbi tükrözi a tudomány álláspontját is.

"Jézus Krisztus mitikus alak - ha már a görög vallás istenei is mitikusak -, Jehshua ben Josef/Galileai Jehshua ellenben valós történelmi alak volt."

Biztos?

"Marginális az a koncepció, ami minimális hatást gyakorol és egyébként se nagyon foglalkoznak vele."

Mi lenne, ha kiegyeznénk abban, hogy a hatás időben relatív, s a vita ezen részét illetően maximálisan irreleváns?

"Az összes Ízisz-főpapnő létezett. Legfeljebb kiderült róluk, hogy nem messiások.
Abu Isa szintén történelmi alak, csak éppen róla is kiderült, hogy állításával szemben nem Megváltó."

Az Ízisz papnő személye a legkevésbé sem számított, csak az, hogy előéletében teljesüljenek azok a kritériumok, ami által Ízisszé válhat.

A tudomány mai állása szerint Abu Isa amúgy nagy valószínűséggel éppen egy mesterségesen konstruált személy volt egy olyan szekta által, akik a tanítványaiknak hazudták magukat.

"Talán mert a kettő nem függ egymástól? Másrészt honnan veszed azt, hogy a manifesztáció képezné a vallás alapját? "

Honnan tudhatnánk biztosan, hogy létezett is Jézus, mit mondott valójában? Nem ez a lényeg. Az alakja köré felépített hiedelemrendszer alapja a manifesztáció.

"Innentől annulálódik is az, amit állítottál."

Miért is?

"Mivel jellemzően beszélő neveket használtak régen, ez nem sok mindent jelent."

Azért valljuk be, igen szerencsés véletlen volt :)

"Egyelőre semmiféle ellenérved nem állta meg a helyét. Jézus, mint történelmi alak létezett."

Hé, nem engem terhel a bizonyítás terhe, hanem azt, aki váltig állítja, hogy a varázshippinek valamilyen formában mindenképpen léteznie kellett. Hogyan építhetnék "helytálló" érveket egy ilyen képlékeny szarkupacra, amit te meg Mystes prezentáltok idáig?

"Ettől még létezett, mert csak létező személynek vannak tanítványai, rokonai, mondásai, hívei és ellenségei."

Szerintem te alábecsülöd a csalásból profitálni kívánó emberek leleményességét. :)

Mystes 2010.12.12. 18:47:34

@Opett:
"Az én manóim és a te istened közt csak annyi a különbség, hogy az egyikben emberek milliói hisznek. Semmi több."
Azért ez mégiscsak némi különbségnek tűnik, nem? Apropó: akkor ezek szerint jól válaszoltam? :)

Mystes 2010.12.12. 18:49:57

@GalBob:
"Szerintem meg az ontológiai random bullshit-gyártás ezerszer könnyebb, mint érdemben a létezők összességével, tehát az univerzum természetével foglalkozni."
Azért ezt a bejegyzést nem mutatjuk meg Platónnak, Heideggernek, de még Wittgensteinnek sem, oké? :)

Opett 2010.12.12. 19:00:22

@Mystes: Ez nem lényeges különbség. Pl Nagy-Britanniában, a 20. század elejéig gyakori volt a koboldokban, tündérekben való hit. Attól, hogy elhiszik sokan, nem lesz kevésbé abszurdabb valami.
Ezek csupán az emberi elméről és kultúráról mondanak valamit.

GalBob 2010.12.12. 19:02:43

@Mystes: Ezután már nem az a kérdés, hogy jól válaszoltál-e vagy sem, hanem hogy ez az egyetlen különbség érdemben számít-e vagy sem. Ha azt feleled, igen, akkor eljutottunk ahhoz a szellemileg deficites állapothoz, ahol egy hiedelem igazságtartalma a kapcsolódó doxa elterjedtsége révén válik mérhetővé.

Mystes 2010.12.12. 19:03:29

Ghavintól már nagyon sok kijelentést hallottunk arra vonatkozóan, hogy: nem. De ő ezt csak -dogmatikusan-állítja, hogy ne mondjam (vallásosan) mantrázza (úristen, rossz belegondolni!), anélkül, hogy megindokolná. Kértem, hogy hozzon kritériumokat arra vonatkozóan, hogy mitől lesz történelmi személy valaki. Ez nem történt meg. Pedig nagyon fontos volna, már csak a történettudomány szempontjából is. Jó lenne már ebben a szarkupacban tisztán látni! :)

Mystes 2010.12.12. 19:07:35

@Opett:
"Ez nem lényeges különbség. Pl Nagy-Britanniában, a 20. század elejéig gyakori volt a koboldokban, tündérekben való hit. Attól, hogy elhiszik sokan, nem lesz kevésbé abszurdabb valami.
Ezek csupán az emberi elméről és kultúráról mondanak valamit."
Indiában ma is nagyon élénk a szellemekben való hit. Nálunk ugyan nem, de például sokan hisznek abban, hogy a forint erősödni fog. Szerinted ez, mármint a különböző hitek, abszurd valami? Mert ha nem, akkor veszek inkább eurót! :)

ghavin 2010.12.12. 19:12:01

@Mystes: Már válaszoltam és meg is indokoltam.

Ghavin 2010.12.10. 07:22:37

Költői kérdés: Miért hazudsz?

Mystes 2010.12.12. 19:13:57

@GalBob:
"Ezután már nem az a kérdés, hogy jól válaszoltál-e vagy sem"
Ennek örülök. Nagy kő esett le a szívemről!

"hanem hogy ez az egyetlen különbség érdemben számít-e vagy sem. Ha azt feleled, igen, akkor eljutottunk ahhoz a szellemileg deficites állapothoz, ahol egy hiedelem igazságtartalma a kapcsolódó doxa elterjedtsége révén válik mérhetővé."
Örülök, hogy Te is a Feltámadás biztos fundamentumába akarod vetni horgonyodat, és nem érdekel, hogy az attól eltérő (világ) vallások számbeli fölényben vannak. Nem a mennyiség, a minőség számit! Ja, és persze az elvek :)

Mystes 2010.12.12. 19:15:42

@Ghavin:
Ennyi lenne? De hogy' csináljak én ebből történeti módszertant!?

GalBob 2010.12.12. 19:33:11

@Mystes: Azért vicces, hogy az ontológiai kérdésekbe való belekontárkodást kikéred a tudománytól, ellenben te gyönyörűen élsz a létező legpitiánerebb szofizmussal, s még egy smiley-t is képes voltál bebigyeszteni mellé. Lehet, hogy Platón az ontológiai bullshit-gyártáson besértődne, de látva amit művelsz, téged még fel is pofozna.
Nyilvánvalóan nem maradt más a tarsolyodban az abszurd hiedelmeidbe való görcsös ragaszkodásnál. Remélem nem bánod, hogy nem kérdezem meg, hogy a feltámadás miért igaz, a többi vallás meg miért nem - tudod a teológia nálam nagyjából egy szinten áll a sci-fi geekery-vel, a Star Wars pedig példának okáért sokkal izgalmasabb a bibliai történeteknél :)

ghavin 2010.12.12. 19:38:48

@Mystes: Neked nem kell sehogyan sem. Elégedj meg annyival, hogy a jelenlegi módszertan tökéletesen működik, s a történelemtudomány képes a helyén kezelni a vallások~mítoszok jeles alakjait.

Mystes 2010.12.12. 19:45:34

@GalBob:
1., "Lehet, hogy Platón az ontológiai bullshit-gyártáson besértődne, de látva amit művelsz, téged még fel is pofozna."
Ez nem szép tőle! A focit sokkal jobban szeretem! :)
www.youtube.com/watch?v=sCfJr-iSACA

2., "Nyilvánvalóan nem maradt más a tarsolyodban az abszurd hiedelmeidbe való görcsös ragaszkodásnál. "
Görcsösnek azért nem nevezném. Jólesik! :)

3., "Remélem nem bánod, hogy nem kérdezem meg, hogy a feltámadás miért igaz, a többi vallás meg miért nem - tudod a teológia nálam nagyjából egy szinten áll a sci-fi geekery-vel, a Star Wars pedig példának okáért sokkal izgalmasabb a bibliai történeteknél :)"
A Star Wars? Ja, azt én is imádom! :)

Mystes 2010.12.12. 19:50:19

@Ghavin:
"Neked nem kell sehogyan sem. Elégedj meg annyival, hogy a jelenlegi módszertan tökéletesen működik, s a történelemtudomány képes a helyén kezelni a vallások~mítoszok jeles alakjait."
Ez tényleg megnyugtató. Szerinte ugyanis Jézus, mint történelmi személy létezése, vitán felül áll :)

KenSentMe 2010.12.12. 19:56:26

@Mystes: Homérosz, mint történelmi személy létezése vitán felül áll?

Mystes 2010.12.12. 19:58:59

Én azért, ettől függetlenül, a mítoszok valóságértelmező erejét semmiképp nem becsülném le. Bármennyire is szeretem a történelmet, és bármennyire is történelmi személy mondjuk Jézus, Mohamed, Moon és társaik, azért még nem vagyok történelembuzi, és nem gondolom, hogy a történettudomány szempontjai mindenen felül állnának. Itt van mindjárt példának Oidipus. Freud nagyon komoly pszichológiai elméletet bontott ki ebből a történetből. Vagy mondjuk James Joyce Ulysses-e, ami örök szimbóluma marad a kereső és bolyongó emberi léleknek - ami ugye szintén mindannyiunk által megtapasztalt valóság... Ezek szimbolikus erejéhez a történettudomány sosem fog felérni, mert nem is teheti. Igazad van Ghavin: mindent a maga helyén! :)

Mystes 2010.12.12. 20:05:43

@VRbagoly:
"Homérosz, mint történelmi személy létezése vitán felül áll?"

Kedves VRBagoly, csak nem képzeled, hogy felülök egy ilyen ócska provokációnak? Hiszen világos, hogy az Odüsszeiát egy (vagy több) mítikus személy írta! Mítikus téntával.

Meg aztán: mi az, hogy "vitán felül áll"? Veled még nem volt az, hogy a csillagokat is le akartad tagadni az égről, ha úgy kívántad? Nem láttál még bírósági pert? Ugyan mit nem lehet vitatni, ha úgy akarjuk? Vegyél már példát Ghavinról, légyszíves! Vagy ha nem, akkor mi a fenének vagyunk itt? :)

Mystes 2010.12.12. 20:07:24

Ja, én meg már megyek is, mert ehhez a bloghoz nem vagyok elég szkeptikus. Pedig az itt -végül is- alapkövetelmény! :))

KenSentMe 2010.12.12. 20:31:22

@Mystes:
Csak a te egyik mondatodat írtam egy kicsit át, ez nem volt provokáció. Ezt te írtad pár kommentel feljebb:

"(a történelemtudomány) .. szerinte ugyanis Jézus, mint történelmi személy létezése, vitán felül áll :)"

figyelembe véve, hogy..
"Meg aztán: mi az, hogy "vitán felül áll"? Veled még nem volt az, hogy a csillagokat is le akartad tagadni az égről, ha úgy kívántad? Nem láttál még bírósági pert? Ugyan mit nem lehet vitatni, ha úgy akarjuk? "

örülök neki, hogy Jézus történelmi személy voltát sem érzed vitán felül állónak;)

Mystes 2010.12.12. 20:48:54

@VRbagoly:
Már hogyne érezném vitán felül (nem) állónak. Hiszen azért vitatkozok róla annyit!

PS:
De, ne írjatok ilyen jó kommenteket, mert akkor nem tudok elmenni más blogokra :)

Opett 2010.12.12. 21:24:40

@Mystes: Látod, már megint viccelődsz :) . Bár csak remélem, hogy nem gondolod komolyan, hogy a tündérekben való hit, és egy valuta értékének valamilyen irányban való változásába vetett hit egy szinten van.

Mystes 2010.12.12. 21:43:19

@Opett:
Persze, hogy nem gondolom! A tündérek sokkal fontosabbak! :)

Opett 2010.12.12. 22:16:59

@Mystes: Akkor lehet hogy egyetértünk, hogy a tündérek pont annyira valósak, mint Jézus :)

Peter T. Sinclare 2010.12.12. 22:29:25

@Ghavin: "Mivel éppen ezt próbáljuk eldönteni, ne kerekítsünk már hirtelen axiómát a vitatott állításról."

Azt próbáljuk eldönteni, Jézus létezett-e. Mivel kétféle Jézusról beszélhetünk, és nálad ez a kettő néha tetszőlegesen keveredik, akartam tiszta vizet önteni a pohárba.

Tehát: a történelmi Jézus létezett, mivel a közvetett bizonyítékok ezt mutatják. A mitikus Jézus meg évszázadok vallási átalakulásának eredménye.

"
Számodra egyértelműen következik, számomra meg nem. Utóbbi tükrözi a tudomány álláspontját is."

De csalafinta :) A "tudomány álláspontjából" kettő is akad:
1. Jézus, mint történelmi alak, létezett
2. Jézus, mint történelmi alak, nem létezett.

"Mi lenne, ha kiegyeznénk abban, hogy a hatás időben relatív, s a vita ezen részét illetően maximálisan irreleváns?"

A hatás időbelisége evidens volt eddig is. Ahogy az is, hogy egyes koncepciók helyzete sem állandó.

"Az Ízisz papnő személye a legkevésbé sem számított, csak az, hogy előéletében teljesüljenek azok a kritériumok, ami által Ízisszé válhat."

Dehogynem számít! Történelmi alak volt mind. Van a kultusztól független beszámoló mindegyik főpapnőről, amelyben név szerint említik őket?

"A tudomány mai állása szerint Abu Isa amúgy nagy valószínűséggel éppen egy mesterségesen konstruált személy volt egy olyan szekta által, akik a tanítványaiknak hazudták magukat."

Erre én azért még aludnék párat. Mondjuk úgy, hogy Abu Isa létezése bizonytalan jelenleg. Mózes sem egy személy volt, mégis létezett mindegyik történelmi személy, akinek az alakját egybegyúrták.
Bar Kochba is lehet, hogy csak egy közös hallucináció eredménye, nem? Mert ki hinne pont a rómaiaknak, akikről köztudott, hogy Pergamonnal hamisíttattak maguknak dicső múltat?
Vagy a görög kortárs történetíróknak? Róluk még a rómaiak is úgy tartották, hazudnak.

Vagy említsük meg Egyiptomot, ahol a történetírás állami propaganda volt?

Tehát a kortárs források egyáltalán nem megbízhatóak.

Ezért ha vannak hívek, tanítványok, közösség, tanok, akkor középen kell lennie valakinek.

Persze feltételezhetjük, hogy egy szekta hazudik magának egy vezért, de akkor feltételezhetjük azt is, hogy tényleg gravimanók tartanak mindenkit a földön.

Occam borotvájáról még nem hallottál?

"Honnan tudhatnánk biztosan, hogy létezett is Jézus, mit mondott valójában?"

Mantrázd csak, ettől még nem lesz igaz.
Valóban honnan tudhatnánk, hogy ő mondta a Jézus-mondásokat? Honnan tudhatjuk, hogy bármely írás attól a szerzőtől származik, akinek tulajdonítják? Bármit lehet hamisítani. Shakespeare sem írt semmit, mint az köztudott ;)
Jézus ráadásul csak beszélt, tehát a mondásait horrible dictu! más írta le.

"Nem ez a lényeg. Az alakja köré felépített hiedelemrendszer alapja a manifesztáció."

Nem. Az alap a történeti személy, az a reformer zsidó, aki meg akarta változtatni a korabeli vallásosságot, majd be akarta teljesíteni a próféciákat. Belehalt. Biztosan voltak, akik már életében elkezdték misztifikálni, majd halála után indult be igazán a csodavárás.
És még amikor először kijelentették, hogy Jézus volt a Felkent, sőt Isten Fia, már akkor voltak olyan követői, akik ezt elvetették.
Jézus sosem mondta, hogy bárminek/bárkinek is a manifesztációja volna.

"Innentől annulálódik is az, amit állítottál."

Miért is?"
Nincs türelmem újra leírni.

"Azért valljuk be, igen szerencsés véletlen volt :)"

:) valóban az ügyét szolgálta, bár még így is magyarázni kellett, miért is nem Immánuelnek nevezték :)

"Hé, nem engem terhel a bizonyítás terhe, hanem azt, aki váltig állítja, hogy a varázshippinek valamilyen formában mindenképpen léteznie kellett. Hogyan építhetnék "helytálló" érveket egy ilyen képlékeny szarkupacra, amit te meg Mystes prezentáltok idáig?"

Ácsi, Mysteshez semmi közöm, nem foglalkozom vele.
Miért kell újra és újra leírni, hogy a hatások és közvetett bizonyítékok miatt a logikus, ésszerű és tudományos következtetés az, hogy létezett egy történelmi alak?

"Szerintem te alábecsülöd a csalásból profitálni kívánó emberek leleményességét. :) "

Persze :) Tutira egy ultramazochista közösség lehetett, mert a pénzüket szétosztották és a kereszthalált kockáztatták. Valóban, frankó csalás! Nem csupán elszegényedsz, de még ki is végezhetnek érte. Cserébe meg kiválasztott lehetsz, aki elnyeri az örök boldogságot a napokon belül eljövendő új világban. Amit ööö... valaki megígért. Igen, mintha lett volna valaki, aki ezt megígérte. Nem?
Nem, Smuel, emlékezz, mi találtuk ki a Rabbit, hogy elhitessük az emberekkel, hogy ha szegények lesznek velünk együtt és a halállal játszanak, akkor majd jó lesz nekik odaát.

OMG.

Mystes 2010.12.12. 22:36:30

@Opett:
Ne térjünk el a tárgytól. Ne tündéreskedjünk! maycontainnuts írt egy jó bevezető posztot, arról kell itt beszélni, nem másról! Térjünk tehát vissza az ID fikázásához. Tudod, a lelki komfort mindenekelőtt! :)

Mystes 2010.12.12. 22:43:10

"Persze feltételezhetjük, hogy egy szekta hazudik magának egy vezért."
Gyerekek, ne hülyéskedjünk már! Ha hazudnak maguknak egy vezért, akkor olyan vezért hazudnak, akit követni lehet. De miféle követőkre számíthatnak egy zsidó környezetben azok, akikről a tanítványai azt mondják, hogy ő azt mondta: "igyátok, ez az én vérem". Pont Zsidóországban, ahol mindenféle vérivás tilos!

Opett 2010.12.12. 23:09:12

@Mystes: Ez a "hazudnak maguknak egy vezért" eléggé sarkított megfogalmazás, nem csak így alakulhatott ki a történet.
Pl. voltak őskeresztény felekezetek, akik nem hitték, hogy Jézus fizikailag létezett, hanem csupán szellemi lényként hittek benne. Volt olyan őskeresztény szekták, akik abban hittek, hogy Jézus nem megszületett, hanem felnőtt testként manifesztálódott. Az is egy lehetőség, hogy Jézusra eredetileg mint szellemi lényben hittek, majd a szimbólikus történeteket valakik komolyan vették.

Az ID-t meg nem kell bántani, szerintem már eléggé ki vannak vesézve. Bár az eredeti, vitaoldalon található cikk szerintem telitalálat.

Mystes 2010.12.12. 23:15:26

@Opett:
Erről a "szellemi lényről" egyébként feljegyezték az evangéliumok, hogy egyszer, amikor nyilvánosan prédikált, és az anyja haza akarta vinni azzal, hogy "biztos meghibbantál, fiam", akkor az meg elküldte őt a jó édes k*rva anyjába azzal, hogy "nem vagy te az én anyám, én azokhoz tartozok, akik itt most hallgatnak engem".

Szellemi lény! Naná.

Opett 2010.12.13. 01:38:50

@Mystes: Wow. Nagyon nem akarod érteni. Nem mondtam, hogy minden csoport ezt hitte, csak hogy volt ilyen is.
Nem csak a 4 kanonikus evangélium létezik. Ha jól emlékszem legalább 30 volt. Különböző csoportok különbözőeket használtak. Tamás gyerekkori evangéliumában (bár ez tudom, kései) pl a gyerek Jézus arra használja varázserejét, hogy rosszalkodjon, pl. játszótársa halálát okozza, meg agyaggalambokat varázsol élővé.

Mystes 2010.12.13. 01:59:22

@Opett:
Ahogy mondod, tényleg szörnyűek ezek a (naiv) irományok. Akkor már sokkal inkább a 4 kanonikuss! :)

Tamással mindig csak a baj van.

Mystes 2010.12.13. 02:02:23

@Opett:
Látod, látod. Ahogy ezeket a tamáskodásokat elnézem, azon már nem is csodálkozom, hogy Mohamednek mit hadovált az Angyal összevissza "Isáról", meg a mai könyvkínálaton sem csodálkozom, ahol Jézus meg indiai prófétává válik. Jó lesz vigyázni! :)

pounderstibbons 2010.12.13. 10:39:37

@Mystes:

Te vagy az egyik legjobb példa arra, hogy miért nem kell a vallásnak a tudománytól (incl. evolúció) félnie.

Térdig jársz már a "tamáskodó" kommentekben, és meg se rezdül a hited. Ami hited szempontjából bizonyára örvendetes, viszont a vitát eléggé egyoldalúvá és erősen feleslegessé teszi.

Jézus pedig "Tamáskodó" tanítványától nem várta el, hogy higgyen neki, hanem magához engedte, hogy a saját szemével és kezével tapasztalja meg a bizonyítékot.

Ehhez hasonló módon vizsgálja a világot a tudomány, és bár Jézus boldognak nevezte azokat, akik "nem látnak, mégis hisznek", de hozzájuk hasonlóan boldognak nevezte korábban azokat is, akik szomjúhozzák az igazságot.

Mystes 2010.12.13. 13:29:33

@pounderstibbons:
Ez egy nagyon szép beírás volt! :)

Peter T. Sinclare 2010.12.13. 14:26:54

@Opett: Meg valószínűleg Jézusnak a testvérei is mind szellemi lények voltak :) Egyről még az ÚSz is név szerint beszél.

Peter T. Sinclare 2010.12.13. 14:29:11

@Opett: Valóban voltak ilyen csoportok, de ezek már mind jóval később jöttek létre, mint az ősközösség. Másrészt a holdkórosok akkor sem érdekeltek túl sok embert. Ma is vannak lapos Föld hívek, de őszintén - ez megrendíti a tudományt bármennyire is? :D

ghavin 2010.12.13. 14:50:51

@Peter T. Sinclare: "Azt próbáljuk eldönteni, Jézus létezett-e. Mivel kétféle Jézusról beszélhetünk, és nálad ez a kettő néha tetszőlegesen keveredik, akartam tiszta vizet önteni a pohárba."

Nem véletlenül keveredik, ugyanis a rendelkezésünkre álló források alapján nem lehet meghúzni a határt, hogy meddig tart a feltételezett "történelmi", tehát valóban létező Jézus, s hol kezdődik a mitologikus varázshippi. A kettő összefolyik. Én pedig amellett kardoskodok, hogy a vallások~mítoszok természetéből adódóan a mitikus alakok körüli hatásokból nem feltétlenül következik, hogy adott esetben létezett ott bármi is a realitásban.

"Tehát: a történelmi Jézus létezett, mivel a közvetett bizonyítékok ezt mutatják."

De értsd már meg, hogy ez így ebben a formában nem igaz! Egyáltalán nem biztos, hogy létezett történelmi Jézus, de ha létezett is, képtelenség úgy tanulmányozni az alakhoz kapcsolódó hatásokat, mintha egy történelmi személyt kutatnánk.

"De csalafinta :) A "tudomány álláspontjából" kettő is akad:
1. Jézus, mint történelmi alak, létezett
2. Jézus, mint történelmi alak, nem létezett."

Igen, s ez korántsem eldöntött kérdés, hiába próbálod beállítani annak.

"Dehogynem számít! Történelmi alak volt mind. Van a kultusztól független beszámoló mindegyik főpapnőről, amelyben név szerint említik őket?"

Pont az a lényeg, hogy nem említik őket név szerint! Hát nem érted, hogy arra próbálok kilyukadni, hogy az Ízisz-kultusz mintájára egy szekta tagjai maguk is megkonstruálhatták no nem a megváltó, hanem konkrétan Jézus alakját, majd ezen paradigma alapján valaki magára vette ezt a szerepet? Éppen azért vetettem fel, mert egyáltalán nem egyértelmű, hogy a páli egyházalapítást megelőző időkben pontosan hogyan is zajlottak az őskeresztény rituálék.

"Occam borotvájáról még nem hallottál?"

Én végig amellett foglaltam állást, hogy korántsem egyértelmű Jézus, mint történelmi személy egykori létezése, s ez éppen az Occam borotvája elv alapján mondható ki. Ezzel nem jelentem ki kategorikusan, hogy Jézus, mint történelmi személy létezése bármivel is valószínűtlenebb lenne annál, hogy egy teljesen mesterségesen konstruált alakról van szó, pusztán azon érvemet támasztottam alá, hogy a történelemtudomány nem kezelheti semelyik Jézus-alakot történelmi személyként, mivel a valós és legendás elemek határát képtelenség meghatározni.

"Miért kell újra és újra leírni, hogy a hatások és közvetett bizonyítékok miatt a logikus, ésszerű és tudományos következtetés az, hogy létezett egy történelmi alak?"

Mert egy vallás kutatásakor, különösen ha kereszténységről van szó, képtelenség az ésszerűség ilyetén közbeiktatása. Két féléven keresztül hallgattam vallástudományt (nem keverendő a teológiával) és bizton állíthatom, hogy képtelenség racionális alapokra helyezni a keresztény források kutatását. Valaki felemlegette a Star Wars-t - tényleg leginkább ahhoz hasonlítható a módszer, mint amikor a kutatás idejére felfüggesztjük a kétkedést, s mindent evidens tényként kezelünk, s ezt próbáljuk rendszerezni. Amint kilépünk ebből, tudjuk, hogy ha volt is bármi valóságmagva a hiedelemrendszernek, képtelenség lenne feltárni.

"Persze :)"

Miért ne? A vallásos alapon történő kommunába tömörülés remek alternatívát jelentett azok számára, akik kiszolgáltatott helyzetükből adódóan képtelenek voltak a mindenkori társadalom szabályai szerint fennmaradni, ám egy kommuna működéséhez rengeteg ember egyidejű összefogására van szükség. Abban a történelmi környezetben a babona volt a legjobb szervezőerő.

Mystes 2010.12.13. 16:03:42

@Ghavin:
"Egyáltalán nem biztos, hogy létezett történelmi Jézus, de ha létezett is, képtelenség úgy tanulmányozni az alakhoz kapcsolódó hatásokat, mintha egy történelmi személyt kutatnánk."

Abban nagyon igazad van, hogy rendkívül fogas probléma az úgynevezett történeti Jézus-kutatás. Elég csak Albert Schweitzer Geschichte der Leben-Jesu-Forschung című híres művére utalni. Persze, azóta már több évtized telt el.
Abban is igazad van, hogy Jézus életét nehéz pusztán történelmi személyként kutatni, hiszen a róla szóló Evangéliumok inkább hitvallások, amik már a feltámadás fényében íródtak. Végül is: ő nem csak ember, hanem Isten is. S mint ilyen, a történelmet transzcendálja.

Opett 2010.12.13. 17:49:37

@Mystes: Érdekes a vitastílusod, ha rámutatok egy érved gyengeségére, akkor elkezdesz ironizálni, meg poénkodni, és megpróbálod elröhögcsélni a dolgot. Mindegy, ez biztos valami mentális védelmi mechanizmus, hogy a hit állapotában tudj maradni. Remélem, nincs harag, de nekem így ehhez nincs kedvem.

@Peter T. Sinclare: Tudtommanl nem. Pl.: Pál is említi valamelyik levelében, mint eretnekeket, azokat a keresztényeket, akik tagadják, hogy volt feltámadás, vagy vmi ilyesmi. Éspedig Pál levelei a legkorábbi dokumentumok Jézusról. Megelőzik az evangéliumokat is. És Pálnak Jézus mint "látomás" jelent meg.
Mindenesetre nem állítom, hogy biztosan ez történt, ez csupán egy lehetőség, szerintem valószínő.

Richard Carrier tartott az egyik Scepticonon egy könnyed, jópofa előadást a mítosz hipotézisről, fenn van youtubon. Érdemes megnézni, érdekes perspektíva.

Peter T. Sinclare 2010.12.13. 20:02:13

@Ghavin: "Nem véletlenül keveredik, ugyanis a rendelkezésünkre álló források alapján nem lehet meghúzni a határt, hogy meddig tart a feltételezett "történelmi", tehát valóban létező Jézus, s hol kezdődik a mitologikus varázshippi. A kettő összefolyik."

No lám, kezdünk eljutni valahova.
Igen, összefolyik a kettő. Azt tudjuk megmondani, mi biztosan mítosz és mi biztosan valóság. A kettő közötti mezsgye pedig... nos, eldönthetetlen.

"Én pedig amellett kardoskodok, hogy a vallások~mítoszok természetéből adódóan a mitikus alakok körüli hatásokból nem feltétlenül következik, hogy adott esetben létezett ott bármi is a realitásban."

Tudom. Csakhogy ha felmerül egy mitikus alakról, hogy létezett a valóságban is, máris nem kezelheted kizárólag mitikus alakként!

"De értsd már meg, hogy ez így ebben a formában nem igaz! Egyáltalán nem biztos, hogy létezett történelmi Jézus, de ha létezett is, képtelenség úgy tanulmányozni az alakhoz kapcsolódó hatásokat, mintha egy történelmi személyt kutatnánk."

:) :)
Ez eddig is tiszta volt. Inkább te értsd meg, hogy minimum egy TFH kijár neki. Ha hozzávesszük azt, hogy divat volt akkoriban a messiásvárás és a messiások minden bokorban megteremtek, akkor inkább van okunk azt feltételezni, hogy egy volt az önjelölt messiások közül, mintsem hogy egy szekta kitalált alakja lett volna.

"Igen, s ez korántsem eldöntött kérdés, hiába próbálod beállítani annak."

Ezt olvasd fel magadnak is ;)

"Pont az a lényeg, hogy nem említik őket név szerint! Hát nem érted, hogy arra próbálok kilyukadni, hogy az Ízisz-kultusz mintájára egy szekta tagjai maguk is megkonstruálhatták no nem a megváltó, hanem konkrétan Jézus alakját, majd ezen paradigma alapján valaki magára vette ezt a szerepet?"

Csakhogy Ízisz-kultusz esetében létezett mindegyik főpapnő, akiben a hitük szerint Ízisz manifesztálódott. Tehát mindegyik főpapnő: történeti személy.
A krisztuskövetők esetében ésszerűbb egy rabbit feltételezni, aki messiásnak vallotta magát - mondom, volt ilyenből elég -, mintsem hogy egy szekta kitalált egy messiást magának!

Már az is árulkodó, hogy a feltámadott Jézust kizárólag a tanítványok látták, senki más: egyszerűbb lett volna azt terjeszteni, hogy mindenki látta - mint a halálánál az ég elsötétedését, földrengést, stb. -, mintsem hogy azt állítani, hogy a feltámadott Mestert kizárólag a csoport elitje láthatta... Mivel ez utóbbi eset áll fent, ebből inkább következik az, hogy a csoport ismerte a rabbit, akit kivégeztek, mintsem hogy nem volt ilyen.

"Éppen azért vetettem fel, mert egyáltalán nem egyértelmű, hogy a páli egyházalapítást megelőző időkben pontosan hogyan is zajlottak az őskeresztény rituálék."

Ezt valóban nehéz kideríteni.

"Én végig amellett foglaltam állást, hogy korántsem egyértelmű Jézus, mint történelmi személy egykori létezése, s ez éppen az Occam borotvája elv alapján mondható ki. Ezzel nem jelentem ki kategorikusan, hogy Jézus, mint történelmi személy létezése bármivel is valószínűtlenebb lenne annál, hogy egy teljesen mesterségesen konstruált alakról van szó, pusztán azon érvemet támasztottam alá, hogy a történelemtudomány nem kezelheti semelyik Jézus-alakot történelmi személyként, mivel a valós és legendás elemek határát képtelenség meghatározni."

Én pedig éppen amellett érvelek, hogy elég sok bizonyítékunk van arra, hogy ésszerűbb egy valós történeti személyt feltételezni, mintsem egy szekta konspirációjának vélni az egészet.

"Mert egy vallás kutatásakor, különösen ha kereszténységről van szó, képtelenség az ésszerűség ilyetén közbeiktatása. Két féléven keresztül hallgattam vallástudományt (nem keverendő a teológiával) és bizton állíthatom, hogy képtelenség racionális alapokra helyezni a keresztény források kutatását."

Akkor valamit nagyon rosszul tanítottak neked. Bármely vallás nagy biztonsággal kutatható, de vallásként kell hozzájuk viszonyulni. Azaz tudni kell, hogy a hívek számára más a realitás, mint az empirikus-racionalista szekuláris (nyugati) kutatók számára.

Ráadásul miért kéne a kereszténységet kiemelni? A hinduizmus, a judaizmus, a konfucianizmus, az iszlám - mind erős homály fedi a keletkezésüket. Vegyük például a judaizmust. Hány Mózes volt? Elephantine szigetén kívül éltek-e zsidók (héberek) Egyiptomban a Ptolemaida kor előtt? Mikor írták meg a Pentateuchoszt és miért került bele három jól elkülöníthető "törvénycsomag"? Honnan ered Jahve neve? Milyen mértékben dolgozták bele a Genezisbe a mezopotámiai és ugariti mítoszkincset? Stb.

"Valaki felemlegette a Star Wars-t - tényleg leginkább ahhoz hasonlítható a módszer, mint amikor a kutatás idejére felfüggesztjük a kétkedést, s mindent evidens tényként kezelünk, s ezt próbáljuk rendszerezni. Amint kilépünk ebből, tudjuk, hogy ha volt is bármi valóságmagva a hiedelemrendszernek, képtelenség lenne feltárni."

Ez eléggé defetista hozzáállás, mintha a ki nem mondott célja az lenne, hogy kijelenthesse valaki, semmit sem lehet biztosan tudni ezen vallások keletkezéséről, eredetéről, a korai állapotairól. Dehogynem lehet!

"Miért ne? A vallásos alapon történő kommunába tömörülés remek alternatívát jelentett azok számára, akik kiszolgáltatott helyzetükből adódóan képtelenek voltak a mindenkori társadalom szabályai szerint fennmaradni,"

Úgymint: halászok, adószedők, stb.?
Vagy mint Saul, aki római polgár volt, hellenizált zsidó és nem kellett a "számlák miatt aggódnia"?

"ám egy kommuna működéséhez rengeteg ember egyidejű összefogására van szükség. Abban a történelmi környezetben a babona volt a legjobb szervezőerő. "

A babona nem jó kifejezés - a messiásvárás ugyanis nem babona.
Egy ilyen közösség nem jön létre vezető nélkül. Nézd meg az esszénusokat: voltak vezetőik, várták a Messiást, de egyik vezető sem mondta, hogy ő volna az. Tehát egy közösség számára egyáltalán nem volt szükség arra, hogy messiást találjon ki magának. Ellenben volt vezetőre szüksége, aki megszervezte és egyben tartotta a közösséget.

Peter T. Sinclare 2010.12.13. 20:13:19

@Opett: Pál levelei legalább húsz évvel Jézus halála után keletkeztek. Egy emberöltő egy friss csoport esetében meglehetősen sok idő. Ennyi idő alatt már kialakul és megszilárdul a Mester alakja körüli első mítoszréteg, és aki ekkor kapcsolódik be, az bárki szemtanúval is beszél, már ezt a félig valós-félig mitikus személyt ismerheti meg.

Szkeptikus Blog · http://szkeptikus.blog.hu 2010.12.13. 20:35:00

Kérjük, hogy a Jézussal kapcsolatos vitát valahol máshol folytassátok, ugyanis ez a cikk nem erről szól. Ajánljuk a fórumunk Történelem rovatát: forum.szkeptikus.hu

Mystes 2010.12.13. 20:48:20

@Opett:
Pontosan mi is az, amit tudni szeretnél?

Fira Heffner 2010.12.15. 14:30:54

Igen. Meg ez a folytonos udvariaskodás minden kóklerrel, sarlatánnal, miegymással lassan kezd olyan képet festeni a sz.t.-ról mintha a célja nem a harc lenne ezek ellen, hanem a békés egymás mellett létezés... Ennek így nem sok értelme van.

Fira Heffner 2010.12.15. 14:32:31

szerintem ez a "simulósan beszéljük meg" stratégia sehova sem vezet.

pounderstibbons 2010.12.15. 14:54:06

@Fira Heffner:
Korábban nem volt vita.
Az hova vezetett?

A mostani pedig nem éppen simulós. Elég csak a fenti cikket, vagy akár a legújabb Értemes cikket megnézni a vitáról:
ertem.hu/page/becsuletes-tudomanyert/

@Tényfeltáró:
Szerinted a Tervező-Télapó párhuzam felvállalhatatlan, ha valaki tudományos állásponton akar maradni?

fordulo_bogyo 2010.12.15. 16:31:49

Matyas ott teved, hogy ez nem tudomanyos vita, es tarsadalmi vita. A tudomanyban -iagaz van - nincs vita az evoluciotol, tenykent kezelik.

A tarsadalomban van vita, Azon, hogy mit tanitsanak az iskolaban. Es ezt nem a tudomanyos konszenzus donti el, hanem a tarsadalom, a politika.

Fira Heffner 2010.12.15. 19:57:01

@pounderstibbons:

Ha nem is simulós, de elégé finomkodós. Egy laikusnak úgy tünik az egész így, mintha nem lenne elég municója a sz.t.-nak, és ezért óvatkoskodik. Mivel nem csak biológusok figyelik ezt a vitát, ezért ha a sz. társaság valóban elakarja érni ama célját h lerántsa a leplet az értem csacskaságairól, akkor jobb lenne ha szembetünöbben és "agresszívabban" lép fel az ilyen dolgokkal szemben. (most nem csak az értem-re gondolok)

Úgy, hogy érezhető legyen ténylegesen h kinél van az igazság. Mivel elég gyakran olyan emberek döntenek olyan dolgokról amihez nem értenek, ezért ezeknek a dolgoknak úgy kell "átmennie" a nyilvánossághoz, hogy még egy hülyének is egyértelmünek kell lennie hogy miről van szó.

(arra gondolok, ha nem figyel oda az ember, akkor a végén még az ilyen áltudományos dolgokat fogják tanítani az iskolában bizonyított tényként.)

maycontainnuts 2010.12.16. 14:34:36

@Fira Heffner:
A fenti cikkben található hangvételnél én (egyelőre) megállnék. Az erősebb hangnem általában kontraproduktív.
(Megjegyzem, hogy te is "csacskaságok"-at írtál, nem pedig valami jóval nyomatékosabb kifejezéstl!)

A kezdeti hozzászólók között 1-2, már ezt az agresszivitási szintet is sokallta a mi oldalunkról, de volt akinek tetszett a hangvétel, pedig nem éppen a simulós vitastílusáról híres.
( facepalm.freeblog.hu )

Amit igazán érdekesnek tartok, hogy kifejezetten Értem rajongó megszólalásokból mintha nem jött volna egy sem. (a Jézus személye körüli és ontológiai vitát nem venném ennek)

Akkor most ők is így egyetértenek a vita eddigi folyásáról írt értékelésemmel, vagy csak a cica elvitte a nyelvüket? Esetleg várják, hogy az Értelmes Tervező adjon választ helyettük?

Az Értelmetlen Tervezettség Mozgalom reakciósebessége mintha sokkal gyorsabb lenne náluk:
bolygoideg.blog.hu/2010/12/13/a_tervezett_nyomdahiba_nyilt_level

Vasárnap este telik le az Értemnek járó két hét, kíváncsian várom, mit tesznek le a fa alá.

Brendel Mátyás · http://ateistaklub.blog.hu/ 2010.12.16. 15:17:34

@fordulo_bogyo:

"Matyas ott teved, hogy ez nem tudomanyos vita, es tarsadalmi vita."

Egy tudományos, és nem egy társadalmi kérdésről.

"A tarsadalomban van vita, Azon, hogy mit tanitsanak az iskolaban. Es ezt nem a tudomanyos konszenzus donti el, hanem a tarsadalom, a politika."

Amennyiben a vita erről folyna, akkor semelyik fél sem volna illetékes benne.

Ez esetben össze kellene hívni pedagógusokat, tudományfilozófusokat, szociológusokat azügyben, hogy helyes-e az az elve, hogy "az iskolában tudományos kérdésekben az elfogadott tudományos álláspontot érdemes tanítani"

mielőtt valaki belekötne:

"ettől csak akkor lehet eltérni, ha ez meghaladja a tanulók képességeit, és létezik egy egyszerűbb, praktikus, közelítő modell".

ez a newtoni fizika miatt kellett.:)

namost ez egy jó vita volna, ezt a csatát simán meg lehetne nyerni, és ebből következik, hogy az evolúciót KELL tanítani.

ehelyett az evolúcióról vitázni az ÉRTEMMEL, baromság.

Brendel Mátyás · http://ateistaklub.blog.hu/ 2010.12.16. 15:23:14

@fordulo_bogyo:

tehát képzeljünk el mondjuk egy olyan beszélgetést, ahol a tudományfilozófus, a pedagógia-szakértó, a szociológus összeül, és arról beszélnek, hogy általában helyes-e a tudományt tanítani az iskolában!

nem tudom, kiállna-e bárki is olyan állásponttal, hogy igenis a geicentrikus és a lapos föld világképét kell tanítani az iskolában, mint igaz elméletet.

de ha mégis, akkor ezt a vitát könnyedén meg lehetne nyerni kommunikációs szinten.

és akkor ebből következik, hogy az evolúciót kell tanítani. a vitának azt a részét ezzel kizárnánk, amely egyáltalán meg meri kérdezni, hogy helyes-e az evolúció.

érveléstechnikailag, kommunikáció szempontjából ez egy nagyon jó megoldás volna.

ehhez képest önként feladni a védővonalakat, és beengedni Tasi Istvánt az első védvonal mögé, hát az bornírt egy dolog.

pounderstibbons 2010.12.16. 15:36:00

@Brendel Mátyás:
"Ez esetben össze kellene hívni pedagógusokat, tudományfilozófusokat, szociológusokat azügyben, hogy helyes-e az az elve, hogy "az iskolában tudományos kérdésekben az elfogadott tudományos álláspontot érdemes tanítani" "

És ez a sok nembiológus majd mind dönt a biológiaoktatásról, úgy, hogy többségük utoljára középiskolában hallott róla, majd azt követően a társadalmi vita hiányában csak az evolúció ellenzőit hallgathatta.

Ahogy ez pl. Romániában történt is:

hvg.hu/Tudomany/20081208_romania_evolucio_nemzeti_alaptanterv

zsylvester.blogspot.com/2008/03/teaching-of-evolution-in-romania.html

"namost ez egy jó vita volna, ezt a csatát simán meg lehetne nyerni, és ebből következik, hogy az evolúciót KELL tanítani."

Mint szoms